Mutagenetix > Incidental Mutation

Incidental Mutation 'R6685:Dsg3'

527660

Institutional Source

Beutler Lab

Gene Symbol

Dsg3

Ensembl Gene

ENSMUSG00000056632

Gene Name

desmoglein 3

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.480) question?

Stock #

R6685 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20510304-20541310 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 20520615 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000064718 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070892]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000070892

SMART Domains

Protein: ENSMUSP00000064718
Gene: ENSMUSG00000056632

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	70	155	3.9e-13	SMART
CA	179	265	2.36e-21	SMART
CA	288	382	1.55e-7	SMART
CA	409	493	6.15e-11	SMART
low complexity region	615	638	N/A	INTRINSIC
low complexity region	643	657	N/A	INTRINSIC
low complexity region	725	736	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein exhibit loss of keratinocyte cell adhesion resulting in a phenotype that resembles that of patients with pemphigus vulgaris. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutants display runting from decreased food intake due to oropharyngeal epithelial lesions, blisters around snout and eyes, hair loss by weaning, and hair regrowth with bald patches throughout life. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox1	G	T	11: 116,180,348	Y203*	probably null	Het
Adcy5	A	G	16: 35,279,216	N712S	possibly damaging	Het
Adgrb3	G	A	1: 25,111,736	Q1139*	probably null	Het
Casc3	A	G	11: 98,822,530	K257E	probably damaging	Het
Cttnbp2nl	G	T	3: 105,005,498	Q357K	probably benign	Het
Dcst1	A	C	3: 89,356,873	V345G	possibly damaging	Het
Ehbp1	A	G	11: 22,146,641	C308R	probably benign	Het
Etaa1	G	T	11: 17,953,582	D71E	probably benign	Het
Flg	T	C	3: 93,279,409	V56A	possibly damaging	Het
Gpr162	A	G	6: 124,861,531	L52P	probably damaging	Het
Inhbb	A	G	1: 119,417,605	L318P	probably damaging	Het
Lkaaear1	TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG	TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG	2: 181,697,561		probably benign	Het
Mcm8	G	A	2: 132,842,650	R728Q	probably damaging	Het
Metap1	A	T	3: 138,478,834	F126I	possibly damaging	Het
Olfr575	T	C	7: 102,955,681		probably null	Het
Peg10	T	A	6: 4,754,738	V173E	probably damaging	Het
Poteg	T	A	8: 27,447,905	F30I	possibly damaging	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Homo
Sh3rf3	C	T	10: 59,086,841	L580F	possibly damaging	Het
Slc26a7	C	A	4: 14,593,819	V99F	probably damaging	Het
Slc26a7	A	T	4: 14,593,820	H98Q	probably damaging	Het
Slc9a2	A	T	1: 40,718,909	I203F	probably damaging	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Txnrd3	G	A	6: 89,669,915	V347I	possibly damaging	Het
Wisp2	A	G	2: 163,828,948	D125G	possibly damaging	Het
Zfp42	G	A	8: 43,296,056	T136M	possibly damaging	Het

Other mutations in Dsg3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Dsg3	APN	18	20539654	missense	probably damaging	1.00
IGL00697:Dsg3	APN	18	20524689	critical splice donor site	probably null
IGL00966:Dsg3	APN	18	20523607	missense	probably benign	0.02
IGL01352:Dsg3	APN	18	20523696	missense	probably benign	0.25
IGL01953:Dsg3	APN	18	20525304	missense	probably damaging	1.00
IGL02385:Dsg3	APN	18	20527714	missense	probably damaging	1.00
IGL02622:Dsg3	APN	18	20528947	splice site	probably benign
IGL02643:Dsg3	APN	18	20528955	missense	probably benign	0.00
IGL02740:Dsg3	APN	18	20527708	missense	possibly damaging	0.93
IGL03012:Dsg3	APN	18	20537243	critical splice acceptor site	probably null
IGL03026:Dsg3	APN	18	20536972	splice site	probably null
IGL03063:Dsg3	APN	18	20533368	splice site	probably benign
IGL03098:Dsg3	APN	18	20510365	utr 5 prime	probably benign
IGL03132:Dsg3	APN	18	20524596	missense	probably damaging	1.00
IGL03352:Dsg3	APN	18	20527632	missense	probably benign
P0035:Dsg3	UTSW	18	20539969	missense	probably benign	0.05
R0039:Dsg3	UTSW	18	20521484	missense	probably benign	0.36
R0099:Dsg3	UTSW	18	20540022	missense	probably benign	0.01
R0109:Dsg3	UTSW	18	20540134	missense	probably damaging	0.96
R0109:Dsg3	UTSW	18	20540134	missense	probably damaging	0.96
R0143:Dsg3	UTSW	18	20536825	missense	probably damaging	1.00
R0194:Dsg3	UTSW	18	20540142	missense	probably damaging	1.00
R0373:Dsg3	UTSW	18	20539747	missense	probably damaging	1.00
R0517:Dsg3	UTSW	18	20529025	missense	probably benign	0.06
R0521:Dsg3	UTSW	18	20527815	missense	possibly damaging	0.53
R1194:Dsg3	UTSW	18	20525220	missense	probably damaging	0.98
R1551:Dsg3	UTSW	18	20536918	missense	possibly damaging	0.84
R1762:Dsg3	UTSW	18	20539732	missense	probably damaging	1.00
R1957:Dsg3	UTSW	18	20522105	missense	probably damaging	1.00
R2061:Dsg3	UTSW	18	20527737	nonsense	probably null
R2071:Dsg3	UTSW	18	20536825	missense	probably damaging	1.00
R2513:Dsg3	UTSW	18	20523662	missense	possibly damaging	0.48
R2571:Dsg3	UTSW	18	20540005	missense	probably benign	0.01
R2945:Dsg3	UTSW	18	20539935	missense	probably benign
R2968:Dsg3	UTSW	18	20525225	missense	possibly damaging	0.75
R3906:Dsg3	UTSW	18	20538499	missense	probably damaging	1.00
R4616:Dsg3	UTSW	18	20531559	missense	probably benign
R4641:Dsg3	UTSW	18	20520558	missense	probably benign	0.28
R4685:Dsg3	UTSW	18	20539736	missense	probably benign	0.08
R5690:Dsg3	UTSW	18	20522051	missense	probably benign	0.01
R5786:Dsg3	UTSW	18	20521571	missense	possibly damaging	0.46
R5950:Dsg3	UTSW	18	20538529	missense	probably damaging	1.00
R6131:Dsg3	UTSW	18	20538512	missense	probably damaging	0.99
R6131:Dsg3	UTSW	18	20520477	splice site	probably null
R6243:Dsg3	UTSW	18	20539724	missense	probably damaging	1.00
R6315:Dsg3	UTSW	18	20524586	missense	probably benign	0.08
R6327:Dsg3	UTSW	18	20539870	missense	probably benign
R6418:Dsg3	UTSW	18	20523760	critical splice donor site	probably null
R6464:Dsg3	UTSW	18	20533526	missense	probably benign	0.00
R6497:Dsg3	UTSW	18	20537248	missense	probably benign	0.33
R6518:Dsg3	UTSW	18	20533422	missense	probably benign	0.23
R6551:Dsg3	UTSW	18	20539911	missense	unknown
R6952:Dsg3	UTSW	18	20525159	missense	possibly damaging	0.77
R7357:Dsg3	UTSW	18	20539783	missense	probably damaging	1.00
R7385:Dsg3	UTSW	18	20540197	missense	possibly damaging	0.52
R7456:Dsg3	UTSW	18	20531363	missense	probably benign	0.17
R7506:Dsg3	UTSW	18	20533464	missense	probably benign	0.31
R7570:Dsg3	UTSW	18	20527780	missense	possibly damaging	0.95
R7980:Dsg3	UTSW	18	20531360	missense	probably benign	0.00
R8100:Dsg3	UTSW	18	20528971	missense	probably benign	0.08
R8147:Dsg3	UTSW	18	20540073	missense	probably benign
R8242:Dsg3	UTSW	18	20536923	missense	possibly damaging	0.93
R8415:Dsg3	UTSW	18	20523708	missense	probably damaging	1.00
R8494:Dsg3	UTSW	18	20540214	missense	probably benign	0.03
R8930:Dsg3	UTSW	18	20539661	missense	probably damaging	1.00
R8932:Dsg3	UTSW	18	20539661	missense	probably damaging	1.00
R8998:Dsg3	UTSW	18	20533627	missense	probably damaging	1.00
R8999:Dsg3	UTSW	18	20533627	missense	probably damaging	1.00
R9336:Dsg3	UTSW	18	20524685	missense	probably benign	0.19
R9498:Dsg3	UTSW	18	20525221	missense	probably damaging	0.98
R9598:Dsg3	UTSW	18	20539732	missense	probably damaging	1.00
R9601:Dsg3	UTSW	18	20533521	missense	probably damaging	1.00
R9748:Dsg3	UTSW	18	20539704	missense	possibly damaging	0.87
R9794:Dsg3	UTSW	18	20540097	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAGGCACATATGTCATAAAGTGG -3'
(R):5'- ACTAGAGTCTGGTACAAACACC -3'

Sequencing Primer
(F):5'- AGTGGGATCTCTTTCAACACAGC -3'
(R):5'- CTGTGGACTTTCTAGGTTATA -3'

Posted On

2018-07-23