Incidental Mutation 'R6649:Gpat2'
ID 527669
Institutional Source Beutler Lab
Gene Symbol Gpat2
Ensembl Gene ENSMUSG00000046338
Gene Name glycerol-3-phosphate acyltransferase 2, mitochondrial
Synonyms Gpat2, A530057A03Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6649 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 127425199-127436092 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 127432435 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Glycine at position 366 (W366G)
Ref Sequence ENSEMBL: ENSMUSP00000049619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028848] [ENSMUST00000062211]
AlphaFold Q14DK4
Predicted Effect probably benign
Transcript: ENSMUST00000028848
SMART Domains Protein: ENSMUSP00000028848
Gene: ENSMUSG00000027371

DomainStartEndE-ValueType
low complexity region 47 53 N/A INTRINSIC
Pfam:FAA_hydrolase 107 313 3.1e-75 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000062211
AA Change: W366G

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049619
Gene: ENSMUSG00000046338
AA Change: W366G

DomainStartEndE-ValueType
PlsC 199 333 1.45e-11 SMART
Blast:PlsC 347 387 7e-13 BLAST
low complexity region 431 468 N/A INTRINSIC
low complexity region 515 528 N/A INTRINSIC
low complexity region 593 613 N/A INTRINSIC
low complexity region 664 675 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146757
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Abra G A 15: 41,869,233 L146F probably benign Het
Adamts7 T C 9: 90,191,937 C857R probably damaging Het
Ankhd1 A T 18: 36,600,783 probably null Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
Asb16 A T 11: 102,269,037 Q72L possibly damaging Het
Bbox1 G T 2: 110,305,569 H22N probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
C330027C09Rik A T 16: 49,017,466 Q843L probably damaging Het
Cdh18 A T 15: 23,436,534 Y492F possibly damaging Het
Cep290 A C 10: 100,518,531 D848A probably benign Het
Cmya5 G C 13: 93,098,025 S185C possibly damaging Het
Cops9 C T 1: 92,640,414 probably benign Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fam214a T G 9: 75,010,150 L677R probably damaging Het
Fat3 T C 9: 16,376,742 D495G probably damaging Het
Fsip2 T C 2: 82,967,817 V485A possibly damaging Het
Gm14496 A T 2: 181,997,476 H453L possibly damaging Het
Gm17027 T C 14: 42,159,279 T207A unknown Het
Gm6902 T G 7: 23,273,734 T123P possibly damaging Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Hsd17b14 T C 7: 45,556,076 V11A probably damaging Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kmt5b G A 19: 3,807,295 G351R probably damaging Het
Mau2 G T 8: 70,031,516 Q141K possibly damaging Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Mfsd13a A G 19: 46,372,265 H394R probably benign Het
Mfsd14b A T 13: 65,066,785 I451N probably damaging Het
Milr1 C T 11: 106,757,711 H143Y probably benign Het
Mon2 T G 10: 123,038,480 K321T possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Nwd2 A G 5: 63,725,184 R60G possibly damaging Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Olfr691 T C 7: 105,337,707 H3R probably benign Het
Papola A T 12: 105,812,307 I315L possibly damaging Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phyhipl A G 10: 70,569,013 F77L probably damaging Het
Ppp3cb A G 14: 20,531,026 L110P probably damaging Het
Prss53 T G 7: 127,886,575 E531A probably benign Het
Raf1 A T 6: 115,631,341 H236Q probably benign Het
Ryr2 A G 13: 11,595,643 V4099A probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Sh3pxd2b T C 11: 32,415,978 probably null Het
Slco6c1 C T 1: 97,125,711 S155N probably benign Het
Speer4f2 A G 5: 17,375,769 T115A probably benign Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Zfp938 A T 10: 82,225,398 Y463N probably damaging Het
Other mutations in Gpat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Gpat2 APN 2 127432396 missense probably benign 0.01
IGL00479:Gpat2 APN 2 127434461 missense probably damaging 0.99
IGL01393:Gpat2 APN 2 127432651 missense probably damaging 1.00
IGL01759:Gpat2 APN 2 127430896 missense possibly damaging 0.94
IGL01764:Gpat2 APN 2 127427536 missense probably benign 0.18
IGL02631:Gpat2 APN 2 127434232 splice site probably benign
IGL02657:Gpat2 APN 2 127427331 missense probably benign 0.04
IGL02813:Gpat2 APN 2 127434455 missense possibly damaging 0.90
IGL02873:Gpat2 APN 2 127431755 missense probably benign 0.00
IGL02993:Gpat2 APN 2 127427566 missense probably damaging 1.00
Hygroscopic UTSW 2 127431918 missense possibly damaging 0.90
PIT4494001:Gpat2 UTSW 2 127433880 missense probably benign 0.00
R0078:Gpat2 UTSW 2 127428249 missense probably damaging 1.00
R0230:Gpat2 UTSW 2 127435845 missense possibly damaging 0.95
R1619:Gpat2 UTSW 2 127428717 missense probably benign 0.00
R1851:Gpat2 UTSW 2 127434819 missense possibly damaging 0.77
R1939:Gpat2 UTSW 2 127435959 makesense probably null
R2143:Gpat2 UTSW 2 127433762 missense probably damaging 1.00
R2165:Gpat2 UTSW 2 127428291 missense probably damaging 0.97
R2518:Gpat2 UTSW 2 127428291 missense probably damaging 0.97
R3410:Gpat2 UTSW 2 127428291 missense probably damaging 0.97
R3411:Gpat2 UTSW 2 127428291 missense probably damaging 0.97
R3898:Gpat2 UTSW 2 127435098 missense probably damaging 1.00
R4080:Gpat2 UTSW 2 127433622 missense probably damaging 0.99
R4725:Gpat2 UTSW 2 127431982 missense possibly damaging 0.83
R4841:Gpat2 UTSW 2 127433967 missense probably benign 0.10
R5354:Gpat2 UTSW 2 127428723 missense probably damaging 1.00
R5941:Gpat2 UTSW 2 127428275 missense possibly damaging 0.53
R6362:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6374:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6375:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6377:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6380:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6381:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6382:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6383:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6384:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6393:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6565:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6594:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6595:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6665:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6666:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6667:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6668:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R6669:Gpat2 UTSW 2 127431918 missense possibly damaging 0.90
R7031:Gpat2 UTSW 2 127435475 missense probably damaging 0.99
R7096:Gpat2 UTSW 2 127428289 missense probably benign 0.02
R7307:Gpat2 UTSW 2 127434890 missense probably damaging 1.00
R7313:Gpat2 UTSW 2 127428295 missense probably damaging 0.99
R7365:Gpat2 UTSW 2 127426981 splice site probably null
R8111:Gpat2 UTSW 2 127433857 missense probably damaging 1.00
R8113:Gpat2 UTSW 2 127431347 missense possibly damaging 0.52
R8729:Gpat2 UTSW 2 127433819 missense probably damaging 0.99
R9010:Gpat2 UTSW 2 127435226 missense probably benign 0.28
R9146:Gpat2 UTSW 2 127431286 missense possibly damaging 0.58
Z1176:Gpat2 UTSW 2 127430882 missense probably benign
Z1176:Gpat2 UTSW 2 127433808 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCACTATCCTAAAGGGTCTCCC -3'
(R):5'- AGATGTGAGGTCTGCCCTTG -3'

Sequencing Primer
(F):5'- TTGCTATCACCATCTTTCAAAAGACC -3'
(R):5'- AGGTCTGCCCTTGCCACAC -3'
Posted On 2018-07-23