Mutagenetix > Incidental Mutation

Incidental Mutation 'R6649:Gpat2'

527669

Institutional Source

Beutler Lab

Gene Symbol

Gpat2

Ensembl Gene

ENSMUSG00000046338

Gene Name

glycerol-3-phosphate acyltransferase 2, mitochondrial

Synonyms

Gpat2, A530057A03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6649 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

127425199-127436092 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 127432435 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Glycine at position 366 (W366G)

Ref Sequence

ENSEMBL: ENSMUSP00000049619 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028848] [ENSMUST00000062211]

AlphaFold

Q14DK4

Predicted Effect

probably benign
Transcript: ENSMUST00000028848

SMART Domains

Protein: ENSMUSP00000028848
Gene: ENSMUSG00000027371

Domain	Start	End	E-Value	Type
low complexity region	47	53	N/A	INTRINSIC
Pfam:FAA_hydrolase	107	313	3.1e-75	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000062211
AA Change: W366G

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000049619
Gene: ENSMUSG00000046338
AA Change: W366G

Domain	Start	End	E-Value	Type
PlsC	199	333	1.45e-11	SMART
Blast:PlsC	347	387	7e-13	BLAST
low complexity region	431	468	N/A	INTRINSIC
low complexity region	515	528	N/A	INTRINSIC
low complexity region	593	613	N/A	INTRINSIC
low complexity region	664	675	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123327

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137366

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146757

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	T	A	19: 43,812,502	H627Q	probably benign	Het
Abra	G	A	15: 41,869,233	L146F	probably benign	Het
Adamts7	T	C	9: 90,191,937	C857R	probably damaging	Het
Ankhd1	A	T	18: 36,600,783		probably null	Het
Asb15	A	G	6: 24,562,633	N198S	probably benign	Het
Asb16	A	T	11: 102,269,037	Q72L	possibly damaging	Het
Bbox1	G	T	2: 110,305,569	H22N	probably benign	Het
Bcdin3d	T	C	15: 99,470,815	T168A	probably damaging	Het
Bmp1	A	T	14: 70,490,618	W624R	probably damaging	Het
C330027C09Rik	A	T	16: 49,017,466	Q843L	probably damaging	Het
Cdh18	A	T	15: 23,436,534	Y492F	possibly damaging	Het
Cep290	A	C	10: 100,518,531	D848A	probably benign	Het
Cmya5	G	C	13: 93,098,025	S185C	possibly damaging	Het
Cops9	C	T	1: 92,640,414		probably benign	Het
Cutal	C	T	2: 34,885,921	T88I	probably benign	Het
Dlg4	G	T	11: 70,023,953		probably benign	Het
Dnah7c	C	A	1: 46,649,340	T1890K	probably benign	Het
Dnah7c	A	G	1: 46,649,351	S1894G	probably benign	Het
Eef2	CCC	CCCC	10: 81,178,768		probably null	Het
Erp44	T	C	4: 48,205,130	I288V	probably null	Het
Fam214a	T	G	9: 75,010,150	L677R	probably damaging	Het
Fat3	T	C	9: 16,376,742	D495G	probably damaging	Het
Fsip2	T	C	2: 82,967,817	V485A	possibly damaging	Het
Gm14496	A	T	2: 181,997,476	H453L	possibly damaging	Het
Gm17027	T	C	14: 42,159,279	T207A	unknown	Het
Gm6902	T	G	7: 23,273,734	T123P	possibly damaging	Het
Heatr6	A	T	11: 83,759,365	T216S	probably benign	Het
Hsd17b14	T	C	7: 45,556,076	V11A	probably damaging	Het
Jak2	T	A	19: 29,288,710	I517N	probably benign	Het
Kmt5b	G	A	19: 3,807,295	G351R	probably damaging	Het
Mau2	G	T	8: 70,031,516	Q141K	possibly damaging	Het
Mfsd13a	T	C	19: 46,367,866	F137L	probably damaging	Het
Mfsd13a	A	G	19: 46,372,265	H394R	probably benign	Het
Mfsd14b	A	T	13: 65,066,785	I451N	probably damaging	Het
Milr1	C	T	11: 106,757,711	H143Y	probably benign	Het
Mon2	T	G	10: 123,038,480	K321T	possibly damaging	Het
Nlrp9c	T	A	7: 26,371,322	N945Y	probably damaging	Het
Nwd2	A	G	5: 63,725,184	R60G	possibly damaging	Het
Olfr30	A	T	11: 58,455,568	I127N	probably damaging	Het
Olfr44	A	G	9: 39,484,752	V164A	probably benign	Het
Olfr691	T	C	7: 105,337,707	H3R	probably benign	Het
Papola	A	T	12: 105,812,307	I315L	possibly damaging	Het
Phf3	A	T	1: 30,805,023	S1618R	possibly damaging	Het
Phyhipl	A	G	10: 70,569,013	F77L	probably damaging	Het
Ppp3cb	A	G	14: 20,531,026	L110P	probably damaging	Het
Prss53	T	G	7: 127,886,575	E531A	probably benign	Het
Raf1	A	T	6: 115,631,341	H236Q	probably benign	Het
Ryr2	A	G	13: 11,595,643	V4099A	probably damaging	Het
Sfxn3	G	A	19: 45,049,915		probably null	Het
Sh3pxd2b	T	C	11: 32,415,978		probably null	Het
Slco6c1	C	T	1: 97,125,711	S155N	probably benign	Het
Speer4f2	A	G	5: 17,375,769	T115A	probably benign	Het
Spry1	T	C	3: 37,642,722	I38T	probably damaging	Het
Tagap	T	C	17: 7,933,714	V577A	probably benign	Het
Ubr4	C	A	4: 139,473,624	H4706Q	possibly damaging	Het
Vmn2r112	T	A	17: 22,601,179	L11Q	probably null	Het
Zfp60	T	C	7: 27,748,726	F273S	probably benign	Het
Zfp938	A	T	10: 82,225,398	Y463N	probably damaging	Het

Other mutations in Gpat2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Gpat2	APN	2	127432396	missense	probably benign	0.01
IGL00479:Gpat2	APN	2	127434461	missense	probably damaging	0.99
IGL01393:Gpat2	APN	2	127432651	missense	probably damaging	1.00
IGL01759:Gpat2	APN	2	127430896	missense	possibly damaging	0.94
IGL01764:Gpat2	APN	2	127427536	missense	probably benign	0.18
IGL02631:Gpat2	APN	2	127434232	splice site	probably benign
IGL02657:Gpat2	APN	2	127427331	missense	probably benign	0.04
IGL02813:Gpat2	APN	2	127434455	missense	possibly damaging	0.90
IGL02873:Gpat2	APN	2	127431755	missense	probably benign	0.00
IGL02993:Gpat2	APN	2	127427566	missense	probably damaging	1.00
Hygroscopic	UTSW	2	127431918	missense	possibly damaging	0.90
PIT4494001:Gpat2	UTSW	2	127433880	missense	probably benign	0.00
R0078:Gpat2	UTSW	2	127428249	missense	probably damaging	1.00
R0230:Gpat2	UTSW	2	127435845	missense	possibly damaging	0.95
R1619:Gpat2	UTSW	2	127428717	missense	probably benign	0.00
R1851:Gpat2	UTSW	2	127434819	missense	possibly damaging	0.77
R1939:Gpat2	UTSW	2	127435959	makesense	probably null
R2143:Gpat2	UTSW	2	127433762	missense	probably damaging	1.00
R2165:Gpat2	UTSW	2	127428291	missense	probably damaging	0.97
R2518:Gpat2	UTSW	2	127428291	missense	probably damaging	0.97
R3410:Gpat2	UTSW	2	127428291	missense	probably damaging	0.97
R3411:Gpat2	UTSW	2	127428291	missense	probably damaging	0.97
R3898:Gpat2	UTSW	2	127435098	missense	probably damaging	1.00
R4080:Gpat2	UTSW	2	127433622	missense	probably damaging	0.99
R4725:Gpat2	UTSW	2	127431982	missense	possibly damaging	0.83
R4841:Gpat2	UTSW	2	127433967	missense	probably benign	0.10
R5354:Gpat2	UTSW	2	127428723	missense	probably damaging	1.00
R5941:Gpat2	UTSW	2	127428275	missense	possibly damaging	0.53
R6362:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6374:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6375:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6377:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6380:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6381:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6382:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6383:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6384:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6393:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6565:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6594:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6595:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6665:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6666:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6667:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6668:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6669:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R7031:Gpat2	UTSW	2	127435475	missense	probably damaging	0.99
R7096:Gpat2	UTSW	2	127428289	missense	probably benign	0.02
R7307:Gpat2	UTSW	2	127434890	missense	probably damaging	1.00
R7313:Gpat2	UTSW	2	127428295	missense	probably damaging	0.99
R7365:Gpat2	UTSW	2	127426981	splice site	probably null
R8111:Gpat2	UTSW	2	127433857	missense	probably damaging	1.00
R8113:Gpat2	UTSW	2	127431347	missense	possibly damaging	0.52
R8729:Gpat2	UTSW	2	127433819	missense	probably damaging	0.99
R9010:Gpat2	UTSW	2	127435226	missense	probably benign	0.28
R9146:Gpat2	UTSW	2	127431286	missense	possibly damaging	0.58
Z1176:Gpat2	UTSW	2	127430882	missense	probably benign
Z1176:Gpat2	UTSW	2	127433808	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCACTATCCTAAAGGGTCTCCC -3'
(R):5'- AGATGTGAGGTCTGCCCTTG -3'

Sequencing Primer
(F):5'- TTGCTATCACCATCTTTCAAAAGACC -3'
(R):5'- AGGTCTGCCCTTGCCACAC -3'

Posted On

2018-07-23