Incidental Mutation 'R6649:Nlrp9c'
ID 527679
Institutional Source Beutler Lab
Gene Symbol Nlrp9c
Ensembl Gene ENSMUSG00000040614
Gene Name NLR family, pyrin domain containing 9C
Synonyms Nalp9c, Nalp-zeta
MMRRC Submission 044770-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6649 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 26064116-26103125 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 26070747 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 945 (N945Y)
Ref Sequence ENSEMBL: ENSMUSP00000083106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041845] [ENSMUST00000085944]
AlphaFold Q66X01
Predicted Effect possibly damaging
Transcript: ENSMUST00000041845
AA Change: N833Y

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036041
Gene: ENSMUSG00000040614
AA Change: N833Y

DomainStartEndE-ValueType
PYRIN 5 87 7.64e-22 SMART
Pfam:NACHT 143 310 5.2e-31 PFAM
LRR 637 664 4.36e1 SMART
Blast:LRR 666 691 3e-6 BLAST
LRR 693 720 1.02e0 SMART
LRR 722 749 3e0 SMART
LRR 750 777 6.88e-4 SMART
LRR 779 806 5.06e0 SMART
LRR 807 834 1.22e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085944
AA Change: N945Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083106
Gene: ENSMUSG00000040614
AA Change: N945Y

DomainStartEndE-ValueType
PYRIN 5 87 7.64e-22 SMART
Pfam:NACHT 143 310 2.8e-31 PFAM
LRR 631 658 7.49e0 SMART
LRR 692 719 4.36e1 SMART
Blast:LRR 721 746 8e-6 BLAST
LRR 748 775 1.02e0 SMART
LRR 777 804 3e0 SMART
LRR 805 832 6.88e-4 SMART
LRR 834 861 2.17e0 SMART
LRR 862 889 2.12e-4 SMART
LRR 919 946 1.22e1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,800,941 (GRCm39) H627Q probably benign Het
Abra G A 15: 41,732,629 (GRCm39) L146F probably benign Het
Adamts7 T C 9: 90,073,990 (GRCm39) C857R probably damaging Het
Ankhd1 A T 18: 36,733,836 (GRCm39) probably null Het
Asb15 A G 6: 24,562,632 (GRCm39) N198S probably benign Het
Asb16 A T 11: 102,159,863 (GRCm39) Q72L possibly damaging Het
Atosa T G 9: 74,917,432 (GRCm39) L677R probably damaging Het
Bbox1 G T 2: 110,135,914 (GRCm39) H22N probably benign Het
Bcdin3d T C 15: 99,368,696 (GRCm39) T168A probably damaging Het
Bmp1 A T 14: 70,728,058 (GRCm39) W624R probably damaging Het
Cdh18 A T 15: 23,436,620 (GRCm39) Y492F possibly damaging Het
Cep290 A C 10: 100,354,393 (GRCm39) D848A probably benign Het
Cip2a A T 16: 48,837,829 (GRCm39) Q843L probably damaging Het
Cmya5 G C 13: 93,234,533 (GRCm39) S185C possibly damaging Het
Cops9 C T 1: 92,568,136 (GRCm39) probably benign Het
Cutal C T 2: 34,775,933 (GRCm39) T88I probably benign Het
Dlg4 G T 11: 69,914,779 (GRCm39) probably benign Het
Dnah7c C A 1: 46,688,500 (GRCm39) T1890K probably benign Het
Dnah7c A G 1: 46,688,511 (GRCm39) S1894G probably benign Het
Eef2 CCC CCCC 10: 81,014,602 (GRCm39) probably null Het
Erp44 T C 4: 48,205,130 (GRCm39) I288V probably null Het
Fat3 T C 9: 16,288,038 (GRCm39) D495G probably damaging Het
Fsip2 T C 2: 82,798,161 (GRCm39) V485A possibly damaging Het
Gm14496 A T 2: 181,639,269 (GRCm39) H453L possibly damaging Het
Gm17027 T C 14: 41,981,236 (GRCm39) T207A unknown Het
Gm6902 T G 7: 22,973,159 (GRCm39) T123P possibly damaging Het
Gpat2 T G 2: 127,274,355 (GRCm39) W366G possibly damaging Het
Heatr6 A T 11: 83,650,191 (GRCm39) T216S probably benign Het
Hsd17b14 T C 7: 45,205,500 (GRCm39) V11A probably damaging Het
Jak2 T A 19: 29,266,110 (GRCm39) I517N probably benign Het
Kmt5b G A 19: 3,857,295 (GRCm39) G351R probably damaging Het
Mau2 G T 8: 70,484,166 (GRCm39) Q141K possibly damaging Het
Mfsd13a T C 19: 46,356,305 (GRCm39) F137L probably damaging Het
Mfsd13a A G 19: 46,360,704 (GRCm39) H394R probably benign Het
Mfsd14b A T 13: 65,214,599 (GRCm39) I451N probably damaging Het
Milr1 C T 11: 106,648,537 (GRCm39) H143Y probably benign Het
Mon2 T G 10: 122,874,385 (GRCm39) K321T possibly damaging Het
Nwd2 A G 5: 63,882,527 (GRCm39) R60G possibly damaging Het
Or2z2 A T 11: 58,346,394 (GRCm39) I127N probably damaging Het
Or52b2 T C 7: 104,986,914 (GRCm39) H3R probably benign Het
Or8g20 A G 9: 39,396,048 (GRCm39) V164A probably benign Het
Papola A T 12: 105,778,566 (GRCm39) I315L possibly damaging Het
Phf3 A T 1: 30,844,104 (GRCm39) S1618R possibly damaging Het
Phyhipl A G 10: 70,404,843 (GRCm39) F77L probably damaging Het
Ppp3cb A G 14: 20,581,094 (GRCm39) L110P probably damaging Het
Prss53 T G 7: 127,485,747 (GRCm39) E531A probably benign Het
Raf1 A T 6: 115,608,302 (GRCm39) H236Q probably benign Het
Ryr2 A G 13: 11,610,529 (GRCm39) V4099A probably damaging Het
Sfxn3 G A 19: 45,038,354 (GRCm39) probably null Het
Sh3pxd2b T C 11: 32,365,978 (GRCm39) probably null Het
Slco6c1 C T 1: 97,053,436 (GRCm39) S155N probably benign Het
Speer4f2 A G 5: 17,580,767 (GRCm39) T115A probably benign Het
Spry1 T C 3: 37,696,871 (GRCm39) I38T probably damaging Het
Tagap T C 17: 8,152,546 (GRCm39) V577A probably benign Het
Ubr4 C A 4: 139,200,935 (GRCm39) H4706Q possibly damaging Het
Vmn2r112 T A 17: 22,820,160 (GRCm39) L11Q probably null Het
Zfp60 T C 7: 27,448,151 (GRCm39) F273S probably benign Het
Zfp938 A T 10: 82,061,232 (GRCm39) Y463N probably damaging Het
Other mutations in Nlrp9c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Nlrp9c APN 7 26,084,013 (GRCm39) missense probably benign 0.00
IGL00814:Nlrp9c APN 7 26,084,175 (GRCm39) missense probably benign 0.23
IGL00919:Nlrp9c APN 7 26,093,481 (GRCm39) nonsense probably null
IGL01762:Nlrp9c APN 7 26,084,850 (GRCm39) missense probably damaging 1.00
IGL01928:Nlrp9c APN 7 26,074,847 (GRCm39) splice site probably benign
IGL02008:Nlrp9c APN 7 26,084,576 (GRCm39) missense probably benign 0.16
IGL02389:Nlrp9c APN 7 26,093,632 (GRCm39) missense probably benign
IGL02535:Nlrp9c APN 7 26,071,522 (GRCm39) missense probably damaging 1.00
IGL02685:Nlrp9c APN 7 26,084,982 (GRCm39) missense probably damaging 0.98
IGL02904:Nlrp9c APN 7 26,074,715 (GRCm39) missense probably damaging 1.00
IGL02935:Nlrp9c APN 7 26,084,701 (GRCm39) missense probably benign 0.00
IGL03006:Nlrp9c APN 7 26,071,507 (GRCm39) missense probably damaging 0.98
IGL03140:Nlrp9c APN 7 26,079,914 (GRCm39) missense probably benign 0.30
IGL03201:Nlrp9c APN 7 26,084,533 (GRCm39) missense probably benign 0.00
IGL03243:Nlrp9c APN 7 26,064,457 (GRCm39) missense probably damaging 0.99
holy_grail UTSW 7 26,081,837 (GRCm39) missense probably benign
IGL03054:Nlrp9c UTSW 7 26,081,701 (GRCm39) splice site probably null
K7894:Nlrp9c UTSW 7 26,084,323 (GRCm39) missense possibly damaging 0.94
R0018:Nlrp9c UTSW 7 26,071,423 (GRCm39) missense possibly damaging 0.89
R0018:Nlrp9c UTSW 7 26,071,423 (GRCm39) missense possibly damaging 0.89
R0238:Nlrp9c UTSW 7 26,077,437 (GRCm39) missense possibly damaging 0.90
R0238:Nlrp9c UTSW 7 26,077,437 (GRCm39) missense possibly damaging 0.90
R0335:Nlrp9c UTSW 7 26,093,561 (GRCm39) missense possibly damaging 0.92
R0391:Nlrp9c UTSW 7 26,070,901 (GRCm39) splice site probably benign
R0433:Nlrp9c UTSW 7 26,085,244 (GRCm39) missense probably benign 0.20
R1035:Nlrp9c UTSW 7 26,070,702 (GRCm39) splice site probably benign
R1118:Nlrp9c UTSW 7 26,083,862 (GRCm39) missense probably benign 0.01
R1119:Nlrp9c UTSW 7 26,083,862 (GRCm39) missense probably benign 0.01
R1173:Nlrp9c UTSW 7 26,079,860 (GRCm39) missense probably damaging 1.00
R1519:Nlrp9c UTSW 7 26,077,526 (GRCm39) missense possibly damaging 0.88
R1528:Nlrp9c UTSW 7 26,081,723 (GRCm39) missense probably damaging 0.99
R1616:Nlrp9c UTSW 7 26,083,862 (GRCm39) missense probably benign 0.01
R1774:Nlrp9c UTSW 7 26,093,543 (GRCm39) missense probably benign 0.05
R1789:Nlrp9c UTSW 7 26,079,915 (GRCm39) missense probably benign 0.00
R1869:Nlrp9c UTSW 7 26,084,245 (GRCm39) nonsense probably null
R1870:Nlrp9c UTSW 7 26,084,245 (GRCm39) nonsense probably null
R1920:Nlrp9c UTSW 7 26,084,319 (GRCm39) missense probably damaging 1.00
R1987:Nlrp9c UTSW 7 26,077,481 (GRCm39) missense probably benign 0.31
R2022:Nlrp9c UTSW 7 26,084,221 (GRCm39) missense probably damaging 1.00
R2309:Nlrp9c UTSW 7 26,077,512 (GRCm39) missense probably damaging 1.00
R2327:Nlrp9c UTSW 7 26,074,747 (GRCm39) missense probably damaging 1.00
R3405:Nlrp9c UTSW 7 26,084,707 (GRCm39) missense probably benign 0.01
R3548:Nlrp9c UTSW 7 26,070,876 (GRCm39) missense probably damaging 1.00
R3846:Nlrp9c UTSW 7 26,081,701 (GRCm39) splice site probably null
R4179:Nlrp9c UTSW 7 26,084,086 (GRCm39) missense possibly damaging 0.74
R4460:Nlrp9c UTSW 7 26,077,523 (GRCm39) missense probably damaging 1.00
R4669:Nlrp9c UTSW 7 26,074,793 (GRCm39) missense possibly damaging 0.90
R4708:Nlrp9c UTSW 7 26,084,265 (GRCm39) missense probably benign 0.07
R4810:Nlrp9c UTSW 7 26,077,602 (GRCm39) splice site probably null
R4824:Nlrp9c UTSW 7 26,079,989 (GRCm39) missense possibly damaging 0.49
R4915:Nlrp9c UTSW 7 26,083,885 (GRCm39) missense probably benign 0.34
R4996:Nlrp9c UTSW 7 26,085,172 (GRCm39) missense possibly damaging 0.92
R5468:Nlrp9c UTSW 7 26,064,425 (GRCm39) missense probably benign 0.00
R5525:Nlrp9c UTSW 7 26,083,926 (GRCm39) missense probably damaging 1.00
R5526:Nlrp9c UTSW 7 26,081,791 (GRCm39) missense possibly damaging 0.95
R6020:Nlrp9c UTSW 7 26,084,150 (GRCm39) missense probably benign 0.08
R6175:Nlrp9c UTSW 7 26,077,426 (GRCm39) splice site probably null
R6454:Nlrp9c UTSW 7 26,085,199 (GRCm39) missense possibly damaging 0.91
R6493:Nlrp9c UTSW 7 26,081,812 (GRCm39) missense probably damaging 1.00
R6653:Nlrp9c UTSW 7 26,070,747 (GRCm39) missense probably damaging 1.00
R6739:Nlrp9c UTSW 7 26,084,850 (GRCm39) missense probably damaging 0.99
R6883:Nlrp9c UTSW 7 26,077,556 (GRCm39) missense probably benign 0.18
R7097:Nlrp9c UTSW 7 26,085,046 (GRCm39) missense probably damaging 1.00
R7122:Nlrp9c UTSW 7 26,085,046 (GRCm39) missense probably damaging 1.00
R7174:Nlrp9c UTSW 7 26,084,722 (GRCm39) missense probably benign 0.03
R7365:Nlrp9c UTSW 7 26,070,822 (GRCm39) missense possibly damaging 0.93
R7378:Nlrp9c UTSW 7 26,064,440 (GRCm39) missense probably benign 0.14
R7427:Nlrp9c UTSW 7 26,070,860 (GRCm39) missense probably benign 0.00
R7450:Nlrp9c UTSW 7 26,064,364 (GRCm39) missense probably benign 0.45
R7999:Nlrp9c UTSW 7 26,084,914 (GRCm39) missense possibly damaging 0.94
R8036:Nlrp9c UTSW 7 26,070,864 (GRCm39) missense possibly damaging 0.49
R8056:Nlrp9c UTSW 7 26,085,112 (GRCm39) missense probably damaging 1.00
R8249:Nlrp9c UTSW 7 26,074,778 (GRCm39) nonsense probably null
R8729:Nlrp9c UTSW 7 26,071,428 (GRCm39) missense probably benign 0.12
R9012:Nlrp9c UTSW 7 26,074,733 (GRCm39) missense probably benign 0.18
R9104:Nlrp9c UTSW 7 26,081,837 (GRCm39) missense probably benign
R9106:Nlrp9c UTSW 7 26,081,837 (GRCm39) missense probably benign
R9129:Nlrp9c UTSW 7 26,077,428 (GRCm39) critical splice donor site probably null
R9519:Nlrp9c UTSW 7 26,085,302 (GRCm39) missense possibly damaging 0.91
RF020:Nlrp9c UTSW 7 26,084,649 (GRCm39) missense probably benign
X0065:Nlrp9c UTSW 7 26,079,855 (GRCm39) missense probably damaging 0.99
Z1177:Nlrp9c UTSW 7 26,084,250 (GRCm39) missense possibly damaging 0.54
Z1177:Nlrp9c UTSW 7 26,084,200 (GRCm39) missense probably damaging 1.00
Z1177:Nlrp9c UTSW 7 26,081,773 (GRCm39) missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ACCATAGGATGATTACCCATGAG -3'
(R):5'- TTGATTAGATGCCTAGAACTGGC -3'

Sequencing Primer
(F):5'- CCCATGAGTGCATAGGTATCAATCTG -3'
(R):5'- TTAGATGCCTAGAACTGGCACTGAAC -3'
Posted On 2018-07-23