Incidental Mutation 'R6649:Prss53'
ID527683
Institutional Source Beutler Lab
Gene Symbol Prss53
Ensembl Gene ENSMUSG00000044139
Gene Nameprotease, serine 53
SynonymsBC039632
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.489) question?
Stock #R6649 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location127885841-127890970 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 127886575 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 531 (E531A)
Ref Sequence ENSEMBL: ENSMUSP00000112972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050383] [ENSMUST00000121394] [ENSMUST00000205300]
Predicted Effect probably benign
Transcript: ENSMUST00000050383
SMART Domains Protein: ENSMUSP00000052641
Gene: ENSMUSG00000049739

DomainStartEndE-ValueType
ZnF_C2H2 8 31 1.36e-2 SMART
ZnF_C2H2 67 89 5.29e-5 SMART
ZnF_C2H2 231 253 3.21e-4 SMART
ZnF_C2H2 258 280 9.58e-3 SMART
ZnF_C2H2 286 308 2.24e-3 SMART
low complexity region 345 362 N/A INTRINSIC
ZnF_C2H2 366 388 5.42e-2 SMART
ZnF_C2H2 393 415 8.34e-3 SMART
ZnF_C2H2 457 479 5.9e-3 SMART
ZnF_C2H2 484 506 4.87e-4 SMART
ZnF_C2H2 566 588 2.32e-1 SMART
ZnF_C2H2 606 628 6.32e-3 SMART
ZnF_C2H2 633 655 1.53e-1 SMART
low complexity region 737 750 N/A INTRINSIC
low complexity region 786 797 N/A INTRINSIC
ZnF_C2H2 806 828 2.17e-1 SMART
ZnF_C2H2 833 855 3.69e-4 SMART
ZnF_C2H2 866 889 1.16e-1 SMART
low complexity region 890 911 N/A INTRINSIC
ZnF_C2H2 941 961 9.31e1 SMART
ZnF_C2H2 1035 1057 1.95e-3 SMART
ZnF_C2H2 1062 1084 3.39e-3 SMART
low complexity region 1149 1163 N/A INTRINSIC
ZnF_C2H2 1170 1192 1.58e-3 SMART
ZnF_C2H2 1197 1219 5.42e-2 SMART
ZnF_C2H2 1225 1247 3.69e-4 SMART
ZnF_C2H2 1266 1286 5.12e1 SMART
ZnF_C2H2 1293 1315 3.69e-4 SMART
ZnF_C2H2 1333 1355 3.11e-2 SMART
ZnF_C2H2 1550 1572 5.9e-3 SMART
ZnF_C2H2 1640 1662 1.08e-1 SMART
ZnF_C2H2 1667 1689 4.11e-2 SMART
ZnF_C2H2 1695 1717 4.11e-2 SMART
ZnF_C2H2 1724 1746 1.45e-2 SMART
low complexity region 1751 1764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121394
AA Change: E531A

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112972
Gene: ENSMUSG00000044139
AA Change: E531A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 38 268 3.91e-45 SMART
Tryp_SPc 300 520 9.95e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126662
SMART Domains Protein: ENSMUSP00000123566
Gene: ENSMUSG00000030804

DomainStartEndE-ValueType
VKc 1 111 8.84e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205300
Predicted Effect probably benign
Transcript: ENSMUST00000206340
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Abra G A 15: 41,869,233 L146F probably benign Het
Adamts7 T C 9: 90,191,937 C857R probably damaging Het
Ankhd1 A T 18: 36,600,783 probably null Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
Asb16 A T 11: 102,269,037 Q72L possibly damaging Het
Bbox1 G T 2: 110,305,569 H22N probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
C330027C09Rik A T 16: 49,017,466 Q843L probably damaging Het
Cdh18 A T 15: 23,436,534 Y492F possibly damaging Het
Cep290 A C 10: 100,518,531 D848A probably benign Het
Cmya5 G C 13: 93,098,025 S185C possibly damaging Het
Cops9 C T 1: 92,640,414 probably benign Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fam214a T G 9: 75,010,150 L677R probably damaging Het
Fat3 T C 9: 16,376,742 D495G probably damaging Het
Fsip2 T C 2: 82,967,817 V485A possibly damaging Het
Gm14496 A T 2: 181,997,476 H453L possibly damaging Het
Gm17027 T C 14: 42,159,279 T207A unknown Het
Gm6902 T G 7: 23,273,734 T123P possibly damaging Het
Gpat2 T G 2: 127,432,435 W366G possibly damaging Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Hsd17b14 T C 7: 45,556,076 V11A probably damaging Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kmt5b G A 19: 3,807,295 G351R probably damaging Het
Mau2 G T 8: 70,031,516 Q141K possibly damaging Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Mfsd13a A G 19: 46,372,265 H394R probably benign Het
Mfsd14b A T 13: 65,066,785 I451N probably damaging Het
Milr1 C T 11: 106,757,711 H143Y probably benign Het
Mon2 T G 10: 123,038,480 K321T possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Nwd2 A G 5: 63,725,184 R60G possibly damaging Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Olfr691 T C 7: 105,337,707 H3R probably benign Het
Papola A T 12: 105,812,307 I315L possibly damaging Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phyhipl A G 10: 70,569,013 F77L probably damaging Het
Ppp3cb A G 14: 20,531,026 L110P probably damaging Het
Raf1 A T 6: 115,631,341 H236Q probably benign Het
Ryr2 A G 13: 11,595,643 V4099A probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Sh3pxd2b T C 11: 32,415,978 probably null Het
Slco6c1 C T 1: 97,125,711 S155N probably benign Het
Speer4f2 A G 5: 17,375,769 T115A probably benign Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Zfp938 A T 10: 82,225,398 Y463N probably damaging Het
Other mutations in Prss53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Prss53 APN 7 127886552 missense probably benign
IGL02244:Prss53 APN 7 127888792 missense possibly damaging 0.73
IGL02310:Prss53 APN 7 127886614 missense probably benign 0.37
PIT4515001:Prss53 UTSW 7 127888791 missense probably benign 0.01
R1933:Prss53 UTSW 7 127886262 makesense probably null
R1934:Prss53 UTSW 7 127886748 splice site probably null
R1994:Prss53 UTSW 7 127887393 missense probably benign 0.03
R2304:Prss53 UTSW 7 127888307 missense probably benign
R2307:Prss53 UTSW 7 127890865 missense probably benign
R4934:Prss53 UTSW 7 127888707 missense probably benign
Z1088:Prss53 UTSW 7 127887398 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCTGTCTTGGCCCCTATGG -3'
(R):5'- GTAACCTGCTCCCTAACAGG -3'

Sequencing Primer
(F):5'- CCCTATGGAGTGTGGGAGAC -3'
(R):5'- TAACAGGGCCTCTCTGGG -3'
Posted On2018-07-23