Incidental Mutation 'R6649:Mau2'
ID527684
Institutional Source Beutler Lab
Gene Symbol Mau2
Ensembl Gene ENSMUSG00000031858
Gene NameMAU2 sister chromatid cohesion factor
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6649 (G1)
Quality Score210.009
Status Not validated
Chromosome8
Chromosomal Location70016123-70042734 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 70031516 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 141 (Q141K)
Ref Sequence ENSEMBL: ENSMUSP00000131966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050561] [ENSMUST00000168013] [ENSMUST00000212308] [ENSMUST00000212451] [ENSMUST00000212845]
Predicted Effect probably benign
Transcript: ENSMUST00000050561
AA Change: Q141K

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000054763
Gene: ENSMUSG00000031858
AA Change: Q141K

DomainStartEndE-ValueType
Pfam:Cohesin_load 29 575 5e-131 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168013
AA Change: Q141K

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131966
Gene: ENSMUSG00000031858
AA Change: Q141K

DomainStartEndE-ValueType
Pfam:Cohesin_load 29 576 8.7e-130 PFAM
Pfam:TPR_8 71 105 3.3e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212055
Predicted Effect probably benign
Transcript: ENSMUST00000212308
AA Change: Q141K

PolyPhen 2 Score 0.374 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212401
Predicted Effect probably benign
Transcript: ENSMUST00000212451
AA Change: Q141K

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212596
Predicted Effect probably benign
Transcript: ENSMUST00000212845
AA Change: Q141K

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Abra G A 15: 41,869,233 L146F probably benign Het
Adamts7 T C 9: 90,191,937 C857R probably damaging Het
Ankhd1 A T 18: 36,600,783 probably null Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
Asb16 A T 11: 102,269,037 Q72L possibly damaging Het
Bbox1 G T 2: 110,305,569 H22N probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
C330027C09Rik A T 16: 49,017,466 Q843L probably damaging Het
Cdh18 A T 15: 23,436,534 Y492F possibly damaging Het
Cep290 A C 10: 100,518,531 D848A probably benign Het
Cmya5 G C 13: 93,098,025 S185C possibly damaging Het
Cops9 C T 1: 92,640,414 probably benign Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fam214a T G 9: 75,010,150 L677R probably damaging Het
Fat3 T C 9: 16,376,742 D495G probably damaging Het
Fsip2 T C 2: 82,967,817 V485A possibly damaging Het
Gm14496 A T 2: 181,997,476 H453L possibly damaging Het
Gm17027 T C 14: 42,159,279 T207A unknown Het
Gm6902 T G 7: 23,273,734 T123P possibly damaging Het
Gpat2 T G 2: 127,432,435 W366G possibly damaging Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Hsd17b14 T C 7: 45,556,076 V11A probably damaging Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kmt5b G A 19: 3,807,295 G351R probably damaging Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Mfsd13a A G 19: 46,372,265 H394R probably benign Het
Mfsd14b A T 13: 65,066,785 I451N probably damaging Het
Milr1 C T 11: 106,757,711 H143Y probably benign Het
Mon2 T G 10: 123,038,480 K321T possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Nwd2 A G 5: 63,725,184 R60G possibly damaging Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Olfr691 T C 7: 105,337,707 H3R probably benign Het
Papola A T 12: 105,812,307 I315L possibly damaging Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phyhipl A G 10: 70,569,013 F77L probably damaging Het
Ppp3cb A G 14: 20,531,026 L110P probably damaging Het
Prss53 T G 7: 127,886,575 E531A probably benign Het
Raf1 A T 6: 115,631,341 H236Q probably benign Het
Ryr2 A G 13: 11,595,643 V4099A probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Sh3pxd2b T C 11: 32,415,978 probably null Het
Slco6c1 C T 1: 97,125,711 S155N probably benign Het
Speer4f2 A G 5: 17,375,769 T115A probably benign Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Zfp938 A T 10: 82,225,398 Y463N probably damaging Het
Other mutations in Mau2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01684:Mau2 APN 8 70029245 splice site probably benign
IGL02353:Mau2 APN 8 70019638 missense probably damaging 0.99
IGL02360:Mau2 APN 8 70019638 missense probably damaging 0.99
IGL02990:Mau2 APN 8 70022255 splice site probably benign
PIT4382001:Mau2 UTSW 8 70030652 missense possibly damaging 0.95
R0378:Mau2 UTSW 8 70030655 missense probably damaging 0.99
R0556:Mau2 UTSW 8 70042432 missense probably damaging 1.00
R0558:Mau2 UTSW 8 70042432 missense probably damaging 1.00
R0731:Mau2 UTSW 8 70023612 critical splice donor site probably null
R0987:Mau2 UTSW 8 70027698 missense probably damaging 0.99
R1866:Mau2 UTSW 8 70031492 missense probably damaging 1.00
R2857:Mau2 UTSW 8 70019824 missense probably benign 0.08
R4852:Mau2 UTSW 8 70033177 critical splice donor site probably null
R4893:Mau2 UTSW 8 70030640 critical splice donor site probably null
R4970:Mau2 UTSW 8 70027703 missense possibly damaging 0.94
R5004:Mau2 UTSW 8 70025887 missense probably damaging 1.00
R5012:Mau2 UTSW 8 70031457 splice site probably null
R5248:Mau2 UTSW 8 70028723 missense probably benign 0.11
R6150:Mau2 UTSW 8 70019837 missense probably benign 0.23
R6178:Mau2 UTSW 8 70042537 missense probably damaging 0.96
R6343:Mau2 UTSW 8 70031523 missense probably damaging 0.99
R6838:Mau2 UTSW 8 70039297 splice site probably null
R6959:Mau2 UTSW 8 70033228 missense probably damaging 1.00
R7365:Mau2 UTSW 8 70029234 missense possibly damaging 0.93
R7747:Mau2 UTSW 8 70026723 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- AAGTCATTCAGGTGCCCAAG -3'
(R):5'- AGTGACCAAGATGGGGCTTG -3'

Sequencing Primer
(F):5'- TCATTCAGGTGCCCAAGGAAGAG -3'
(R):5'- CTGTATCAGGGGTTCAGTT -3'
Posted On2018-07-23