Mutagenetix > Incidental Mutations

Incidental Mutation 'R6649:Eef2'

527690

Institutional Source

Beutler Lab

Gene Symbol

Eef2

Ensembl Gene

ENSMUSG00000034994

Gene Name

eukaryotic translation elongation factor 2

Synonyms

Ef-2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R6649 (G1)

Quality Score

217.468

Status

Not validated

Chromosome

Chromosomal Location

81176631-81182498 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

CCC to CCCC at 81178768 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000046101 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047665] [ENSMUST00000047864] [ENSMUST00000056086] [ENSMUST00000178422] [ENSMUST00000218157] [ENSMUST00000219133]

AlphaFold

P58252

Predicted Effect

probably benign
Transcript: ENSMUST00000047665

SMART Domains

Protein: ENSMUSP00000035962
Gene: ENSMUSG00000034974

Domain	Start	End	E-Value	Type
S_TKc	13	275	1.93e-98	SMART
low complexity region	288	299	N/A	INTRINSIC
low complexity region	331	347	N/A	INTRINSIC
low complexity region	349	411	N/A	INTRINSIC
coiled coil region	419	444	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000047864

SMART Domains

Protein: ENSMUSP00000046101
Gene: ENSMUSG00000034994

Domain	Start	End	E-Value	Type
Pfam:GTP_EFTU	17	360	2e-65	PFAM
Pfam:MMR_HSR1	21	159	6.3e-6	PFAM
Pfam:GTP_EFTU_D2	409	486	2.3e-14	PFAM
Pfam:EFG_II	501	568	1.9e-14	PFAM
EFG_IV	621	737	5.56e-27	SMART
EFG_C	739	828	4.06e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000056086

SMART Domains

Protein: ENSMUSP00000049685
Gene: ENSMUSG00000053603

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082507

Predicted Effect

probably benign
Transcript: ENSMUST00000178422

SMART Domains

Protein: ENSMUSP00000137333
Gene: ENSMUSG00000034974

Domain	Start	End	E-Value	Type
S_TKc	13	275	1.93e-98	SMART
low complexity region	288	299	N/A	INTRINSIC
low complexity region	331	347	N/A	INTRINSIC
low complexity region	349	411	N/A	INTRINSIC
coiled coil region	419	444	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217936

Predicted Effect

probably benign
Transcript: ENSMUST00000218157

Predicted Effect

probably benign
Transcript: ENSMUST00000219133

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219329

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219497

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219943

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220076

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation removing the diphthamide modification display partial neonatal lethality, fetal growth retardation and abnormal cell physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	T	A	19: 43,812,502	H627Q	probably benign	Het
Abra	G	A	15: 41,869,233	L146F	probably benign	Het
Adamts7	T	C	9: 90,191,937	C857R	probably damaging	Het
Ankhd1	A	T	18: 36,600,783		probably null	Het
Asb15	A	G	6: 24,562,633	N198S	probably benign	Het
Asb16	A	T	11: 102,269,037	Q72L	possibly damaging	Het
Bbox1	G	T	2: 110,305,569	H22N	probably benign	Het
Bcdin3d	T	C	15: 99,470,815	T168A	probably damaging	Het
Bmp1	A	T	14: 70,490,618	W624R	probably damaging	Het
C330027C09Rik	A	T	16: 49,017,466	Q843L	probably damaging	Het
Cdh18	A	T	15: 23,436,534	Y492F	possibly damaging	Het
Cep290	A	C	10: 100,518,531	D848A	probably benign	Het
Cmya5	G	C	13: 93,098,025	S185C	possibly damaging	Het
Cops9	C	T	1: 92,640,414		probably benign	Het
Cutal	C	T	2: 34,885,921	T88I	probably benign	Het
Dlg4	G	T	11: 70,023,953		probably benign	Het
Dnah7c	C	A	1: 46,649,340	T1890K	probably benign	Het
Dnah7c	A	G	1: 46,649,351	S1894G	probably benign	Het
Erp44	T	C	4: 48,205,130	I288V	probably null	Het
Fam214a	T	G	9: 75,010,150	L677R	probably damaging	Het
Fat3	T	C	9: 16,376,742	D495G	probably damaging	Het
Fsip2	T	C	2: 82,967,817	V485A	possibly damaging	Het
Gm14496	A	T	2: 181,997,476	H453L	possibly damaging	Het
Gm17027	T	C	14: 42,159,279	T207A	unknown	Het
Gm6902	T	G	7: 23,273,734	T123P	possibly damaging	Het
Gpat2	T	G	2: 127,432,435	W366G	possibly damaging	Het
Heatr6	A	T	11: 83,759,365	T216S	probably benign	Het
Hsd17b14	T	C	7: 45,556,076	V11A	probably damaging	Het
Jak2	T	A	19: 29,288,710	I517N	probably benign	Het
Kmt5b	G	A	19: 3,807,295	G351R	probably damaging	Het
Mau2	G	T	8: 70,031,516	Q141K	possibly damaging	Het
Mfsd13a	T	C	19: 46,367,866	F137L	probably damaging	Het
Mfsd13a	A	G	19: 46,372,265	H394R	probably benign	Het
Mfsd14b	A	T	13: 65,066,785	I451N	probably damaging	Het
Milr1	C	T	11: 106,757,711	H143Y	probably benign	Het
Mon2	T	G	10: 123,038,480	K321T	possibly damaging	Het
Nlrp9c	T	A	7: 26,371,322	N945Y	probably damaging	Het
Nwd2	A	G	5: 63,725,184	R60G	possibly damaging	Het
Olfr30	A	T	11: 58,455,568	I127N	probably damaging	Het
Olfr44	A	G	9: 39,484,752	V164A	probably benign	Het
Olfr691	T	C	7: 105,337,707	H3R	probably benign	Het
Papola	A	T	12: 105,812,307	I315L	possibly damaging	Het
Phf3	A	T	1: 30,805,023	S1618R	possibly damaging	Het
Phyhipl	A	G	10: 70,569,013	F77L	probably damaging	Het
Ppp3cb	A	G	14: 20,531,026	L110P	probably damaging	Het
Prss53	T	G	7: 127,886,575	E531A	probably benign	Het
Raf1	A	T	6: 115,631,341	H236Q	probably benign	Het
Ryr2	A	G	13: 11,595,643	V4099A	probably damaging	Het
Sfxn3	G	A	19: 45,049,915		probably null	Het
Sh3pxd2b	T	C	11: 32,415,978		probably null	Het
Slco6c1	C	T	1: 97,125,711	S155N	probably benign	Het
Speer4f2	A	G	5: 17,375,769	T115A	probably benign	Het
Spry1	T	C	3: 37,642,722	I38T	probably damaging	Het
Tagap	T	C	17: 7,933,714	V577A	probably benign	Het
Ubr4	C	A	4: 139,473,624	H4706Q	possibly damaging	Het
Vmn2r112	T	A	17: 22,601,179	L11Q	probably null	Het
Zfp60	T	C	7: 27,748,726	F273S	probably benign	Het
Zfp938	A	T	10: 82,225,398	Y463N	probably damaging	Het

Other mutations in Eef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01303:Eef2	APN	10	81181943	missense	possibly damaging	0.93
IGL01303:Eef2	APN	10	81181982	splice site	probably null
IGL01376:Eef2	APN	10	81178049	unclassified	probably benign
IGL01876:Eef2	APN	10	81180270	missense	probably benign
IGL02000:Eef2	APN	10	81180011	missense	probably benign	0.13
IGL02514:Eef2	APN	10	81179593	missense	probably benign	0.11
IGL03087:Eef2	APN	10	81181247	missense	probably benign	0.12
IGL03389:Eef2	APN	10	81179706	missense	probably benign	0.40
fig	UTSW	10	81180292	missense	possibly damaging	0.50
R0052:Eef2	UTSW	10	81178768	frame shift	probably null
R0178:Eef2	UTSW	10	81180292	missense	possibly damaging	0.50
R0445:Eef2	UTSW	10	81178770	frame shift	probably null
R0497:Eef2	UTSW	10	81181586	missense	probably benign	0.00
R0539:Eef2	UTSW	10	81178768	frame shift	probably null
R0745:Eef2	UTSW	10	81181996	missense	probably benign	0.00
R0811:Eef2	UTSW	10	81178769	frame shift	probably null
R0812:Eef2	UTSW	10	81178769	frame shift	probably null
R0832:Eef2	UTSW	10	81178769	frame shift	probably null
R1136:Eef2	UTSW	10	81178769	frame shift	probably null
R1298:Eef2	UTSW	10	81178768	frame shift	probably null
R1549:Eef2	UTSW	10	81178768	frame shift	probably null
R1550:Eef2	UTSW	10	81180847	missense	probably benign	0.04
R2869:Eef2	UTSW	10	81178767	frame shift	probably null
R2870:Eef2	UTSW	10	81178767	frame shift	probably null
R2871:Eef2	UTSW	10	81178767	frame shift	probably null
R2872:Eef2	UTSW	10	81178767	frame shift	probably null
R3408:Eef2	UTSW	10	81178767	frame shift	probably null
R3414:Eef2	UTSW	10	81177858	missense	probably damaging	0.98
R4291:Eef2	UTSW	10	81179580	missense	probably benign	0.00
R4357:Eef2	UTSW	10	81178767	frame shift	probably null
R4433:Eef2	UTSW	10	81178768	frame shift	probably null
R4577:Eef2	UTSW	10	81178767	frame shift	probably null
R5154:Eef2	UTSW	10	81178767	frame shift	probably null
R5609:Eef2	UTSW	10	81178769	frame shift	probably null
R6545:Eef2	UTSW	10	81181114	missense	probably damaging	1.00
R6650:Eef2	UTSW	10	81178768	frame shift	probably null
R7326:Eef2	UTSW	10	81181282	missense	probably benign	0.26
R7472:Eef2	UTSW	10	81179550	missense	probably benign	0.01
R7579:Eef2	UTSW	10	81178768	frame shift	probably null
R8013:Eef2	UTSW	10	81178196	missense	probably damaging	1.00
R8143:Eef2	UTSW	10	81181348	missense	probably damaging	1.00
R8783:Eef2	UTSW	10	81179665	missense	probably damaging	1.00
R8949:Eef2	UTSW	10	81178684	missense	probably damaging	1.00
R9017:Eef2	UTSW	10	81179653	missense	possibly damaging	0.66
R9115:Eef2	UTSW	10	81178769	frame shift	probably null
R9233:Eef2	UTSW	10	81178834	missense	probably benign	0.26
R9435:Eef2	UTSW	10	81179160	missense	probably benign	0.07
Z1088:Eef2	UTSW	10	81181889	missense	probably damaging	1.00
Z1176:Eef2	UTSW	10	81181158	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACCTTGGAGAGTGCTTGTGTAC -3'
(R):5'- CATCATGGTGGGTCAGAGATTCC -3'

Sequencing Primer
(F):5'- AAAACATACGTGGTCTTCAGGC -3'
(R):5'- TCAGAGATTCCCAGGGAGC -3'

Posted On

2018-07-23