Incidental Mutation 'R6649:Ryr2'
ID 527701
Institutional Source Beutler Lab
Gene Symbol Ryr2
Ensembl Gene ENSMUSG00000021313
Gene Name ryanodine receptor 2, cardiac
Synonyms 9330127I20Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_023868.2; MGI: 99685

Essential gene? Essential (E-score: 1.000) question?
Stock # R6649 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 11553102-12106945 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11595643 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 4099 (V4099A)
Ref Sequence ENSEMBL: ENSMUSP00000127991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156] [ENSMUST00000221527]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000021750
AA Change: V4099A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: V4099A

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 454 648 3.1e-65 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 862 952 1.8e-36 PFAM
Pfam:RyR 976 1066 1.1e-32 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2122 2331 1.2e-71 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2700 2790 1.1e-33 PFAM
Pfam:RyR 2820 2904 7.1e-27 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3829 3947 3.1e-36 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.7e-96 PFAM
Pfam:Ion_trans 4710 4877 8e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170156
AA Change: V4099A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: V4099A

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 451 655 3.5e-73 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 861 955 1.4e-33 PFAM
Pfam:RyR 975 1069 9.2e-34 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2120 2331 3.9e-65 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2699 2793 1.1e-37 PFAM
Pfam:RyR 2819 2907 9.4e-34 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3825 3958 2.3e-42 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.1e-93 PFAM
Pfam:Ion_trans 4705 4865 9.3e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000221527
AA Change: V534A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype Strain: 3640298
Lethality: E9-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]
Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Abra G A 15: 41,869,233 L146F probably benign Het
Adamts7 T C 9: 90,191,937 C857R probably damaging Het
Ankhd1 A T 18: 36,600,783 probably null Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
Asb16 A T 11: 102,269,037 Q72L possibly damaging Het
Bbox1 G T 2: 110,305,569 H22N probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
C330027C09Rik A T 16: 49,017,466 Q843L probably damaging Het
Cdh18 A T 15: 23,436,534 Y492F possibly damaging Het
Cep290 A C 10: 100,518,531 D848A probably benign Het
Cmya5 G C 13: 93,098,025 S185C possibly damaging Het
Cops9 C T 1: 92,640,414 probably benign Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fam214a T G 9: 75,010,150 L677R probably damaging Het
Fat3 T C 9: 16,376,742 D495G probably damaging Het
Fsip2 T C 2: 82,967,817 V485A possibly damaging Het
Gm14496 A T 2: 181,997,476 H453L possibly damaging Het
Gm17027 T C 14: 42,159,279 T207A unknown Het
Gm6902 T G 7: 23,273,734 T123P possibly damaging Het
Gpat2 T G 2: 127,432,435 W366G possibly damaging Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Hsd17b14 T C 7: 45,556,076 V11A probably damaging Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kmt5b G A 19: 3,807,295 G351R probably damaging Het
Mau2 G T 8: 70,031,516 Q141K possibly damaging Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Mfsd13a A G 19: 46,372,265 H394R probably benign Het
Mfsd14b A T 13: 65,066,785 I451N probably damaging Het
Milr1 C T 11: 106,757,711 H143Y probably benign Het
Mon2 T G 10: 123,038,480 K321T possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Nwd2 A G 5: 63,725,184 R60G possibly damaging Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Olfr691 T C 7: 105,337,707 H3R probably benign Het
Papola A T 12: 105,812,307 I315L possibly damaging Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phyhipl A G 10: 70,569,013 F77L probably damaging Het
Ppp3cb A G 14: 20,531,026 L110P probably damaging Het
Prss53 T G 7: 127,886,575 E531A probably benign Het
Raf1 A T 6: 115,631,341 H236Q probably benign Het
Sfxn3 G A 19: 45,049,915 probably null Het
Sh3pxd2b T C 11: 32,415,978 probably null Het
Slco6c1 C T 1: 97,125,711 S155N probably benign Het
Speer4f2 A G 5: 17,375,769 T115A probably benign Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Zfp938 A T 10: 82,225,398 Y463N probably damaging Het
Other mutations in Ryr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Ryr2 APN 13 11834092 splice site probably benign
IGL00757:Ryr2 APN 13 11618604 splice site probably null
IGL00838:Ryr2 APN 13 11568503 missense probably damaging 0.98
IGL00849:Ryr2 APN 13 11585478 missense possibly damaging 0.91
IGL00987:Ryr2 APN 13 11735502 missense probably damaging 0.99
IGL01096:Ryr2 APN 13 11703544 missense probably damaging 1.00
IGL01313:Ryr2 APN 13 11638485 critical splice acceptor site probably null
IGL01349:Ryr2 APN 13 11587239 missense possibly damaging 0.93
IGL01391:Ryr2 APN 13 11556685 missense possibly damaging 0.96
IGL01401:Ryr2 APN 13 11591352 missense possibly damaging 0.80
IGL01412:Ryr2 APN 13 11742036 missense probably benign 0.10
IGL01419:Ryr2 APN 13 11799837 missense possibly damaging 0.51
IGL01432:Ryr2 APN 13 11851204 missense possibly damaging 0.63
IGL01533:Ryr2 APN 13 11721790 missense probably damaging 1.00
IGL01571:Ryr2 APN 13 11721761 missense probably damaging 1.00
IGL01584:Ryr2 APN 13 11601758 critical splice donor site probably null
IGL01611:Ryr2 APN 13 11591316 missense possibly damaging 0.67
IGL01632:Ryr2 APN 13 11594968 missense probably damaging 0.97
IGL01643:Ryr2 APN 13 11692677 missense possibly damaging 0.94
IGL01647:Ryr2 APN 13 11585480 missense probably damaging 1.00
IGL01730:Ryr2 APN 13 11601842 missense possibly damaging 0.86
IGL01834:Ryr2 APN 13 11595425 missense possibly damaging 0.71
IGL01921:Ryr2 APN 13 11554550 missense possibly damaging 0.96
IGL01937:Ryr2 APN 13 11790363 missense probably damaging 1.00
IGL01945:Ryr2 APN 13 11790363 missense probably damaging 1.00
IGL02027:Ryr2 APN 13 11597112 missense probably damaging 1.00
IGL02060:Ryr2 APN 13 11747564 missense probably damaging 1.00
IGL02065:Ryr2 APN 13 11572257 missense possibly damaging 0.92
IGL02084:Ryr2 APN 13 11792762 nonsense probably null
IGL02086:Ryr2 APN 13 11735556 missense probably damaging 1.00
IGL02095:Ryr2 APN 13 11759759 missense probably damaging 0.98
IGL02100:Ryr2 APN 13 11737873 missense possibly damaging 0.92
IGL02122:Ryr2 APN 13 11741869 missense probably damaging 1.00
IGL02202:Ryr2 APN 13 11730388 missense probably damaging 0.97
IGL02202:Ryr2 APN 13 11747658 splice site probably benign
IGL02369:Ryr2 APN 13 11619496 missense possibly damaging 0.68
IGL02383:Ryr2 APN 13 11722721 splice site probably benign
IGL02400:Ryr2 APN 13 11605244 splice site probably benign
IGL02423:Ryr2 APN 13 11745198 missense probably damaging 1.00
IGL02425:Ryr2 APN 13 11745674 missense probably damaging 0.99
IGL02458:Ryr2 APN 13 11705699 missense probably benign 0.15
IGL02602:Ryr2 APN 13 11554511 utr 3 prime probably benign
IGL02694:Ryr2 APN 13 11605189 missense probably damaging 1.00
IGL02726:Ryr2 APN 13 11738320 missense probably damaging 1.00
IGL02747:Ryr2 APN 13 11655677 missense probably damaging 1.00
IGL02795:Ryr2 APN 13 11595190 missense probably benign 0.21
IGL02876:Ryr2 APN 13 11707793 missense probably benign 0.39
IGL02878:Ryr2 APN 13 11918319 missense probably benign 0.10
IGL02887:Ryr2 APN 13 11591269 missense probably damaging 0.97
IGL02926:Ryr2 APN 13 11759835 missense probably damaging 0.99
IGL03030:Ryr2 APN 13 11684479 missense probably damaging 0.99
IGL03064:Ryr2 APN 13 11643902 critical splice acceptor site probably null
IGL03102:Ryr2 APN 13 11635582 splice site probably benign
IGL03152:Ryr2 APN 13 11853150 missense probably damaging 1.00
IGL03176:Ryr2 APN 13 11742023 nonsense probably null
IGL03180:Ryr2 APN 13 11568563 missense possibly damaging 0.95
IGL03213:Ryr2 APN 13 11724387 splice site probably benign
IGL03390:Ryr2 APN 13 11772416 missense probably benign
IGL03410:Ryr2 APN 13 11588147 missense probably damaging 0.99
Arruda UTSW 13 11643895 missense probably damaging 1.00
Arruda2 UTSW 13 11879496 missense probably damaging 1.00
Arruda3 UTSW 13 11555448 missense possibly damaging 0.91
barricuda UTSW 13 11595014 missense probably benign 0.06
BB006:Ryr2 UTSW 13 11594794 missense probably damaging 1.00
BB006:Ryr2 UTSW 13 11690295 nonsense probably null
BB016:Ryr2 UTSW 13 11594794 missense probably damaging 1.00
BB016:Ryr2 UTSW 13 11690295 nonsense probably null
H8562:Ryr2 UTSW 13 11717141 splice site probably benign
IGL02799:Ryr2 UTSW 13 11665962 missense probably damaging 1.00
IGL02991:Ryr2 UTSW 13 11761306 missense probably damaging 0.99
PIT4142001:Ryr2 UTSW 13 11707796 missense probably damaging 0.97
PIT4260001:Ryr2 UTSW 13 11594755 missense possibly damaging 0.93
PIT4458001:Ryr2 UTSW 13 11555448 missense probably benign 0.29
R0003:Ryr2 UTSW 13 11824379 missense probably damaging 1.00
R0004:Ryr2 UTSW 13 11665919 missense probably benign
R0018:Ryr2 UTSW 13 11595223 missense possibly damaging 0.94
R0048:Ryr2 UTSW 13 11595784 missense probably damaging 1.00
R0048:Ryr2 UTSW 13 11595784 missense probably damaging 1.00
R0056:Ryr2 UTSW 13 11669038 missense probably damaging 0.97
R0062:Ryr2 UTSW 13 11869116 critical splice donor site probably null
R0062:Ryr2 UTSW 13 11869116 critical splice donor site probably null
R0080:Ryr2 UTSW 13 11568475 missense probably damaging 0.98
R0116:Ryr2 UTSW 13 11709921 missense probably damaging 1.00
R0148:Ryr2 UTSW 13 11714548 missense probably damaging 1.00
R0206:Ryr2 UTSW 13 11676251 splice site probably benign
R0226:Ryr2 UTSW 13 11772556 missense probably damaging 1.00
R0285:Ryr2 UTSW 13 11716977 missense probably damaging 1.00
R0365:Ryr2 UTSW 13 11668839 missense possibly damaging 0.90
R0401:Ryr2 UTSW 13 11705684 missense probably benign 0.45
R0415:Ryr2 UTSW 13 11869156 missense probably damaging 0.97
R0418:Ryr2 UTSW 13 11834095 splice site probably benign
R0558:Ryr2 UTSW 13 11638443 missense probably damaging 1.00
R0558:Ryr2 UTSW 13 11799861 missense probably damaging 1.00
R0574:Ryr2 UTSW 13 11731669 missense probably benign 0.02
R0586:Ryr2 UTSW 13 11635559 missense probably null
R0601:Ryr2 UTSW 13 11705633 critical splice donor site probably null
R0610:Ryr2 UTSW 13 11622952 missense probably damaging 1.00
R0648:Ryr2 UTSW 13 11724333 missense possibly damaging 0.86
R0727:Ryr2 UTSW 13 11566885 missense probably damaging 1.00
R0743:Ryr2 UTSW 13 11554529 missense probably damaging 0.99
R0821:Ryr2 UTSW 13 11738126 missense probably benign 0.35
R0884:Ryr2 UTSW 13 11554529 missense probably damaging 0.99
R1104:Ryr2 UTSW 13 11669969 missense probably damaging 0.99
R1114:Ryr2 UTSW 13 11945981 missense probably damaging 0.98
R1167:Ryr2 UTSW 13 11660113 missense possibly damaging 0.94
R1238:Ryr2 UTSW 13 11759703 missense probably damaging 1.00
R1239:Ryr2 UTSW 13 11883043 critical splice donor site probably null
R1296:Ryr2 UTSW 13 11687879 splice site probably benign
R1400:Ryr2 UTSW 13 11595076 missense probably benign 0.08
R1439:Ryr2 UTSW 13 11714503 splice site probably benign
R1443:Ryr2 UTSW 13 11779266 missense probably benign 0.19
R1446:Ryr2 UTSW 13 11738149 missense probably benign 0.09
R1458:Ryr2 UTSW 13 11727022 missense probably damaging 0.97
R1497:Ryr2 UTSW 13 11601841 missense probably damaging 0.99
R1505:Ryr2 UTSW 13 11554592 missense possibly damaging 0.84
R1548:Ryr2 UTSW 13 11554549 nonsense probably null
R1551:Ryr2 UTSW 13 11785143 critical splice acceptor site probably null
R1567:Ryr2 UTSW 13 11759677 missense possibly damaging 0.87
R1581:Ryr2 UTSW 13 11794563 missense probably benign 0.01
R1645:Ryr2 UTSW 13 11718482 nonsense probably null
R1686:Ryr2 UTSW 13 11603779 splice site probably benign
R1696:Ryr2 UTSW 13 11731657 missense probably benign 0.02
R1708:Ryr2 UTSW 13 11587442 splice site probably null
R1728:Ryr2 UTSW 13 11587422 missense possibly damaging 0.94
R1745:Ryr2 UTSW 13 11790267 missense probably damaging 1.00
R1771:Ryr2 UTSW 13 11745176 critical splice donor site probably null
R1776:Ryr2 UTSW 13 11745176 critical splice donor site probably null
R1783:Ryr2 UTSW 13 11700371 nonsense probably null
R1801:Ryr2 UTSW 13 11595281 missense probably benign 0.01
R1812:Ryr2 UTSW 13 11560586 missense probably damaging 0.97
R1820:Ryr2 UTSW 13 11587316 missense probably damaging 0.99
R1835:Ryr2 UTSW 13 11769878 missense probably benign 0.06
R1868:Ryr2 UTSW 13 11731700 missense probably benign 0.02
R1869:Ryr2 UTSW 13 11662075 missense probably damaging 0.98
R1884:Ryr2 UTSW 13 11738356 missense probably damaging 0.97
R1892:Ryr2 UTSW 13 11658958 nonsense probably null
R1897:Ryr2 UTSW 13 11750932 missense probably benign 0.09
R1899:Ryr2 UTSW 13 11591336 missense probably benign
R1909:Ryr2 UTSW 13 11700349 missense probably damaging 1.00
R1918:Ryr2 UTSW 13 11556698 missense possibly damaging 0.91
R1937:Ryr2 UTSW 13 11668962 missense probably damaging 1.00
R1943:Ryr2 UTSW 13 11731723 missense probably benign 0.10
R1956:Ryr2 UTSW 13 11681080 missense probably damaging 1.00
R1983:Ryr2 UTSW 13 11585402 splice site probably null
R2018:Ryr2 UTSW 13 11851188 missense possibly damaging 0.59
R2019:Ryr2 UTSW 13 11851188 missense possibly damaging 0.59
R2060:Ryr2 UTSW 13 11595736 missense probably damaging 1.00
R2061:Ryr2 UTSW 13 11665878 splice site probably null
R2088:Ryr2 UTSW 13 11662229 missense probably benign 0.04
R2089:Ryr2 UTSW 13 11945977 missense probably benign 0.23
R2091:Ryr2 UTSW 13 11945977 missense probably benign 0.23
R2091:Ryr2 UTSW 13 11945977 missense probably benign 0.23
R2127:Ryr2 UTSW 13 11712195 missense probably damaging 1.00
R2140:Ryr2 UTSW 13 11560607 missense probably damaging 1.00
R2153:Ryr2 UTSW 13 11577873 missense possibly damaging 0.86
R2179:Ryr2 UTSW 13 11705793 nonsense probably null
R2207:Ryr2 UTSW 13 11810937 missense probably damaging 1.00
R2237:Ryr2 UTSW 13 11662260 missense probably benign 0.18
R2258:Ryr2 UTSW 13 11738216 missense possibly damaging 0.94
R2312:Ryr2 UTSW 13 11738242 missense probably damaging 1.00
R2421:Ryr2 UTSW 13 11591237 missense probably damaging 0.98
R2438:Ryr2 UTSW 13 11801848 missense probably damaging 1.00
R2483:Ryr2 UTSW 13 11759703 missense probably damaging 1.00
R2860:Ryr2 UTSW 13 11593093 missense probably damaging 0.98
R2861:Ryr2 UTSW 13 11593093 missense probably damaging 0.98
R2867:Ryr2 UTSW 13 11761349 missense probably damaging 1.00
R2867:Ryr2 UTSW 13 11761349 missense probably damaging 1.00
R3618:Ryr2 UTSW 13 11772580 critical splice acceptor site probably null
R3876:Ryr2 UTSW 13 11588159 missense probably damaging 0.99
R3906:Ryr2 UTSW 13 11738209 missense possibly damaging 0.87
R3912:Ryr2 UTSW 13 11772427 missense probably damaging 0.99
R4018:Ryr2 UTSW 13 11918414 missense probably damaging 1.00
R4114:Ryr2 UTSW 13 11692682 missense probably damaging 1.00
R4119:Ryr2 UTSW 13 11779267 missense probably benign 0.22
R4127:Ryr2 UTSW 13 11587437 missense possibly damaging 0.91
R4222:Ryr2 UTSW 13 11737873 missense possibly damaging 0.92
R4233:Ryr2 UTSW 13 11750725 missense probably benign 0.20
R4355:Ryr2 UTSW 13 11649812 missense probably benign 0.05
R4384:Ryr2 UTSW 13 11605233 missense probably damaging 0.99
R4422:Ryr2 UTSW 13 11717066 nonsense probably null
R4430:Ryr2 UTSW 13 11735527 missense probably damaging 0.98
R4624:Ryr2 UTSW 13 12106415 missense possibly damaging 0.47
R4663:Ryr2 UTSW 13 11749509 missense possibly damaging 0.47
R4665:Ryr2 UTSW 13 11750685 splice site probably null
R4668:Ryr2 UTSW 13 11593117 missense probably benign
R4677:Ryr2 UTSW 13 11706667 missense probably damaging 0.98
R4679:Ryr2 UTSW 13 11824369 missense probably benign 0.34
R4680:Ryr2 UTSW 13 11595233 missense probably benign 0.04
R4685:Ryr2 UTSW 13 11692646 missense probably damaging 1.00
R4709:Ryr2 UTSW 13 11716998 missense probably damaging 1.00
R4731:Ryr2 UTSW 13 11577909 missense possibly damaging 0.53
R4732:Ryr2 UTSW 13 11577909 missense possibly damaging 0.53
R4733:Ryr2 UTSW 13 11577909 missense possibly damaging 0.53
R4734:Ryr2 UTSW 13 11737753 missense probably damaging 0.99
R4740:Ryr2 UTSW 13 11657047 missense possibly damaging 0.95
R4801:Ryr2 UTSW 13 11708227 missense probably damaging 1.00
R4801:Ryr2 UTSW 13 11687932 missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11708227 missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11687932 missense probably damaging 1.00
R4804:Ryr2 UTSW 13 11717097 missense probably damaging 1.00
R4811:Ryr2 UTSW 13 11655698 missense probably damaging 0.97
R4850:Ryr2 UTSW 13 11668820 missense probably damaging 0.99
R4850:Ryr2 UTSW 13 11745752 missense probably damaging 1.00
R4880:Ryr2 UTSW 13 11752218 missense probably damaging 1.00
R4917:Ryr2 UTSW 13 11594986 missense probably damaging 0.96
R4918:Ryr2 UTSW 13 11594986 missense probably damaging 0.96
R4922:Ryr2 UTSW 13 11709963 missense probably damaging 0.99
R4933:Ryr2 UTSW 13 11945945 missense probably damaging 0.96
R4950:Ryr2 UTSW 13 11742011 missense probably damaging 1.00
R4957:Ryr2 UTSW 13 11785080 missense probably damaging 0.97
R4964:Ryr2 UTSW 13 11714611 missense possibly damaging 0.49
R4964:Ryr2 UTSW 13 11833992 missense probably benign 0.00
R4966:Ryr2 UTSW 13 11714611 missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11833992 missense probably benign 0.00
R4997:Ryr2 UTSW 13 11595306 missense probably benign 0.09
R4998:Ryr2 UTSW 13 11643895 missense probably damaging 1.00
R5033:Ryr2 UTSW 13 11587254 missense possibly damaging 0.93
R5061:Ryr2 UTSW 13 11635536 missense possibly damaging 0.74
R5062:Ryr2 UTSW 13 11700354 missense probably damaging 0.97
R5088:Ryr2 UTSW 13 11712243 nonsense probably null
R5135:Ryr2 UTSW 13 11662130 missense probably benign 0.05
R5138:Ryr2 UTSW 13 11660289 missense probably damaging 1.00
R5168:Ryr2 UTSW 13 11752321 missense probably benign
R5187:Ryr2 UTSW 13 11772452 missense probably damaging 0.99
R5197:Ryr2 UTSW 13 11638430 critical splice donor site probably null
R5262:Ryr2 UTSW 13 11772437 missense probably damaging 0.99
R5325:Ryr2 UTSW 13 11690363 missense probably damaging 0.97
R5381:Ryr2 UTSW 13 11556658 missense probably damaging 1.00
R5437:Ryr2 UTSW 13 11655713 missense probably damaging 1.00
R5477:Ryr2 UTSW 13 11705656 missense probably damaging 1.00
R5497:Ryr2 UTSW 13 11705701 missense probably null 0.15
R5509:Ryr2 UTSW 13 11745601 missense probably damaging 0.98
R5518:Ryr2 UTSW 13 11687909 missense probably benign 0.01
R5571:Ryr2 UTSW 13 11555448 missense possibly damaging 0.91
R5591:Ryr2 UTSW 13 11595014 missense probably benign 0.06
R5619:Ryr2 UTSW 13 11708202 missense probably damaging 1.00
R5630:Ryr2 UTSW 13 11601805 missense probably damaging 1.00
R5644:Ryr2 UTSW 13 11595582 missense probably damaging 0.99
R5667:Ryr2 UTSW 13 11759836 missense probably damaging 1.00
R5775:Ryr2 UTSW 13 11769962 missense probably damaging 1.00
R5836:Ryr2 UTSW 13 11603732 missense probably damaging 1.00
R5858:Ryr2 UTSW 13 11560574 missense probably damaging 0.99
R5934:Ryr2 UTSW 13 11584154 missense probably damaging 0.96
R5939:Ryr2 UTSW 13 11790332 missense probably damaging 0.99
R5941:Ryr2 UTSW 13 11687902 missense probably damaging 1.00
R5945:Ryr2 UTSW 13 11660122 missense probably damaging 1.00
R5946:Ryr2 UTSW 13 11726953 missense probably damaging 1.00
R5966:Ryr2 UTSW 13 11662238 nonsense probably null
R5974:Ryr2 UTSW 13 11714511 splice site probably null
R6104:Ryr2 UTSW 13 11799825 missense probably damaging 1.00
R6118:Ryr2 UTSW 13 11792689 missense possibly damaging 0.69
R6149:Ryr2 UTSW 13 11669017 missense probably benign
R6208:Ryr2 UTSW 13 11895220 missense probably benign 0.04
R6217:Ryr2 UTSW 13 11834078 missense probably damaging 1.00
R6230:Ryr2 UTSW 13 11660107 missense probably damaging 0.99
R6279:Ryr2 UTSW 13 11680999 missense probably damaging 0.97
R6294:Ryr2 UTSW 13 11879496 missense probably damaging 1.00
R6300:Ryr2 UTSW 13 11680999 missense probably damaging 0.97
R6350:Ryr2 UTSW 13 11761396 missense probably damaging 0.98
R6484:Ryr2 UTSW 13 11662383 missense possibly damaging 0.90
R6489:Ryr2 UTSW 13 11834007 missense probably benign 0.29
R6548:Ryr2 UTSW 13 11668821 missense probably damaging 1.00
R6591:Ryr2 UTSW 13 11594723 missense probably benign 0.01
R6623:Ryr2 UTSW 13 11710065 missense probably damaging 1.00
R6691:Ryr2 UTSW 13 11594723 missense probably benign 0.01
R6770:Ryr2 UTSW 13 11738462 missense probably damaging 1.00
R6802:Ryr2 UTSW 13 11686966 missense probably damaging 1.00
R6809:Ryr2 UTSW 13 11726930 missense probably damaging 1.00
R6893:Ryr2 UTSW 13 11829654 missense possibly damaging 0.75
R6911:Ryr2 UTSW 13 11827559 missense possibly damaging 0.50
R6915:Ryr2 UTSW 13 11745601 missense probably damaging 1.00
R6943:Ryr2 UTSW 13 11566948 missense possibly damaging 0.92
R6960:Ryr2 UTSW 13 11801243 missense probably benign 0.28
R6997:Ryr2 UTSW 13 11654380 missense possibly damaging 0.88
R6998:Ryr2 UTSW 13 11712166 missense probably damaging 0.99
R7001:Ryr2 UTSW 13 11794605 missense probably damaging 0.98
R7047:Ryr2 UTSW 13 11824400 missense possibly damaging 0.64
R7089:Ryr2 UTSW 13 11649776 missense probably benign 0.10
R7125:Ryr2 UTSW 13 11669987 missense probably damaging 0.99
R7127:Ryr2 UTSW 13 11655713 missense probably damaging 1.00
R7131:Ryr2 UTSW 13 11640327 missense possibly damaging 0.63
R7131:Ryr2 UTSW 13 11668811 critical splice donor site probably null
R7159:Ryr2 UTSW 13 11810908 missense probably damaging 0.99
R7174:Ryr2 UTSW 13 11801177 missense possibly damaging 0.81
R7180:Ryr2 UTSW 13 11686978 missense probably damaging 1.00
R7182:Ryr2 UTSW 13 11759757 missense probably benign
R7189:Ryr2 UTSW 13 11883123 missense probably damaging 1.00
R7241:Ryr2 UTSW 13 11665913 missense possibly damaging 0.71
R7244:Ryr2 UTSW 13 11597146 missense probably damaging 1.00
R7326:Ryr2 UTSW 13 11738194 missense possibly damaging 0.95
R7331:Ryr2 UTSW 13 11745631 missense probably benign
R7365:Ryr2 UTSW 13 11640275 missense probably damaging 0.99
R7372:Ryr2 UTSW 13 11680999 missense probably damaging 0.97
R7395:Ryr2 UTSW 13 11785111 missense probably damaging 0.98
R7404:Ryr2 UTSW 13 11735620 missense probably damaging 0.97
R7417:Ryr2 UTSW 13 11556748 splice site probably null
R7425:Ryr2 UTSW 13 11705644 missense probably benign 0.20
R7444:Ryr2 UTSW 13 11555463 missense probably benign 0.25
R7456:Ryr2 UTSW 13 11752282 missense probably benign
R7460:Ryr2 UTSW 13 11705710 missense probably benign 0.10
R7474:Ryr2 UTSW 13 11594876 missense probably benign 0.04
R7543:Ryr2 UTSW 13 11638431 critical splice donor site probably null
R7549:Ryr2 UTSW 13 11737985 missense probably benign 0.15
R7558:Ryr2 UTSW 13 11799825 missense probably damaging 1.00
R7565:Ryr2 UTSW 13 11560653 missense possibly damaging 0.84
R7627:Ryr2 UTSW 13 11761327 missense possibly damaging 0.65
R7698:Ryr2 UTSW 13 11761315 missense possibly damaging 0.94
R7702:Ryr2 UTSW 13 11690333 missense probably damaging 0.99
R7719:Ryr2 UTSW 13 11730343 missense possibly damaging 0.94
R7772:Ryr2 UTSW 13 11751011 missense probably benign
R7797:Ryr2 UTSW 13 11801180 missense probably damaging 0.99
R7829:Ryr2 UTSW 13 11827607 missense possibly damaging 0.81
R7855:Ryr2 UTSW 13 11706623 nonsense probably null
R7872:Ryr2 UTSW 13 11595724 missense probably damaging 1.00
R7908:Ryr2 UTSW 13 11792748 missense probably benign 0.01
R7929:Ryr2 UTSW 13 11594794 missense probably damaging 1.00
R7929:Ryr2 UTSW 13 11690295 nonsense probably null
R7952:Ryr2 UTSW 13 11646427 splice site probably null
R8008:Ryr2 UTSW 13 11657094 missense probably benign 0.30
R8011:Ryr2 UTSW 13 11588140 critical splice donor site probably null
R8097:Ryr2 UTSW 13 11945995 missense probably damaging 0.98
R8133:Ryr2 UTSW 13 11603698 missense probably damaging 1.00
R8253:Ryr2 UTSW 13 11827553 missense possibly damaging 0.94
R8278:Ryr2 UTSW 13 11595506 nonsense probably null
R8351:Ryr2 UTSW 13 11799832 missense probably damaging 0.98
R8401:Ryr2 UTSW 13 11668935 missense possibly damaging 0.95
R8403:Ryr2 UTSW 13 11684478 missense possibly damaging 0.95
R8431:Ryr2 UTSW 13 11659008 missense probably benign 0.00
R8509:Ryr2 UTSW 13 11577778 critical splice donor site probably null
R8551:Ryr2 UTSW 13 11560593 missense possibly damaging 0.93
R8684:Ryr2 UTSW 13 11687989 missense probably damaging 0.99
R8735:Ryr2 UTSW 13 11686947 missense probably damaging 0.97
R8766:Ryr2 UTSW 13 11668969 missense probably damaging 0.97
R8817:Ryr2 UTSW 13 11735623 missense possibly damaging 0.95
R8827:Ryr2 UTSW 13 11558048 missense possibly damaging 0.80
R8884:Ryr2 UTSW 13 11779266 missense probably benign 0.19
R8889:Ryr2 UTSW 13 11785104 missense probably damaging 0.99
R8891:Ryr2 UTSW 13 11799882 missense probably damaging 1.00
R8979:Ryr2 UTSW 13 11595038 missense probably benign 0.00
R9013:Ryr2 UTSW 13 11603732 missense probably damaging 0.98
R9040:Ryr2 UTSW 13 11594786 missense probably damaging 0.97
R9044:Ryr2 UTSW 13 11738103 nonsense probably null
R9056:Ryr2 UTSW 13 11595931 missense possibly damaging 0.94
R9084:Ryr2 UTSW 13 11601838 missense probably damaging 1.00
R9113:Ryr2 UTSW 13 11603855 intron probably benign
R9116:Ryr2 UTSW 13 11572299 missense possibly damaging 0.93
R9125:Ryr2 UTSW 13 11654406 missense probably benign 0.28
R9148:Ryr2 UTSW 13 11885538 missense probably benign 0.02
R9210:Ryr2 UTSW 13 11829674 missense probably damaging 0.99
R9212:Ryr2 UTSW 13 11829674 missense probably damaging 0.99
R9233:Ryr2 UTSW 13 11595886 missense possibly damaging 0.77
R9254:Ryr2 UTSW 13 11883116 missense probably damaging 1.00
R9262:Ryr2 UTSW 13 11750968 missense probably damaging 0.97
R9275:Ryr2 UTSW 13 11883090 missense probably benign 0.10
R9278:Ryr2 UTSW 13 11883090 missense probably benign 0.10
R9309:Ryr2 UTSW 13 11706692 missense probably damaging 0.99
R9379:Ryr2 UTSW 13 11883116 missense probably damaging 1.00
R9409:Ryr2 UTSW 13 11681087 missense probably damaging 0.99
R9429:Ryr2 UTSW 13 11794573 missense probably damaging 0.97
R9445:Ryr2 UTSW 13 11772577 missense probably damaging 1.00
R9464:Ryr2 UTSW 13 11737794 missense probably benign 0.00
R9467:Ryr2 UTSW 13 11556604 missense possibly damaging 0.70
R9546:Ryr2 UTSW 13 11587215 critical splice donor site probably null
R9562:Ryr2 UTSW 13 11745218 missense probably damaging 1.00
R9609:Ryr2 UTSW 13 11668962 missense probably damaging 1.00
R9704:Ryr2 UTSW 13 11722760 missense probably damaging 1.00
R9764:Ryr2 UTSW 13 11687049 missense possibly damaging 0.67
R9772:Ryr2 UTSW 13 11594899 missense probably benign 0.13
R9776:Ryr2 UTSW 13 11692713 missense probably damaging 0.98
S24628:Ryr2 UTSW 13 11869156 missense probably damaging 0.97
X0019:Ryr2 UTSW 13 11703501 missense probably benign 0.04
Z1176:Ryr2 UTSW 13 11598611 critical splice acceptor site probably null
Z1176:Ryr2 UTSW 13 11643803 critical splice donor site probably null
Z1176:Ryr2 UTSW 13 11794549 nonsense probably null
Z1177:Ryr2 UTSW 13 11750873 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ATATGAACTGCCTCTTGGACTCC -3'
(R):5'- AGGGGTCATTTCCAAGAGAGAC -3'

Sequencing Primer
(F):5'- CTTGGACTCCTTAACCTGGGG -3'
(R):5'- GGTCATTTCCAAGAGAGACTTCCAC -3'
Posted On 2018-07-23