Mutagenetix > Incidental Mutation

Incidental Mutation 'R6649:Bmp1'

527706

Institutional Source

Beutler Lab

Gene Symbol

Bmp1

Ensembl Gene

ENSMUSG00000022098

Gene Name

bone morphogenetic protein 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6649 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70474558-70520234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70490618 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 624 (W624R)

Ref Sequence

ENSEMBL: ENSMUSP00000022693 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906] [ENSMUST00000227944]

AlphaFold

P98063

Predicted Effect

probably damaging
Transcript: ENSMUST00000022693
AA Change: W624R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: W624R

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
ZnMc	131	273	1.32e-54	SMART
CUB	327	439	4.35e-43	SMART
CUB	440	552	7.86e-50	SMART
EGF_CA	552	593	5.03e-11	SMART
CUB	596	708	1.13e-50	SMART
EGF_CA	708	748	4.81e-8	SMART
CUB	752	864	3.99e-51	SMART
CUB	865	981	7.35e-41	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226246

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226601

Predicted Effect

probably benign
Transcript: ENSMUST00000226906

Predicted Effect

probably benign
Transcript: ENSMUST00000227944

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228501

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	T	A	19: 43,812,502	H627Q	probably benign	Het
Abra	G	A	15: 41,869,233	L146F	probably benign	Het
Adamts7	T	C	9: 90,191,937	C857R	probably damaging	Het
Ankhd1	A	T	18: 36,600,783		probably null	Het
Asb15	A	G	6: 24,562,633	N198S	probably benign	Het
Asb16	A	T	11: 102,269,037	Q72L	possibly damaging	Het
Bbox1	G	T	2: 110,305,569	H22N	probably benign	Het
Bcdin3d	T	C	15: 99,470,815	T168A	probably damaging	Het
C330027C09Rik	A	T	16: 49,017,466	Q843L	probably damaging	Het
Cdh18	A	T	15: 23,436,534	Y492F	possibly damaging	Het
Cep290	A	C	10: 100,518,531	D848A	probably benign	Het
Cmya5	G	C	13: 93,098,025	S185C	possibly damaging	Het
Cops9	C	T	1: 92,640,414		probably benign	Het
Cutal	C	T	2: 34,885,921	T88I	probably benign	Het
Dlg4	G	T	11: 70,023,953		probably benign	Het
Dnah7c	C	A	1: 46,649,340	T1890K	probably benign	Het
Dnah7c	A	G	1: 46,649,351	S1894G	probably benign	Het
Eef2	CCC	CCCC	10: 81,178,768		probably null	Het
Erp44	T	C	4: 48,205,130	I288V	probably null	Het
Fam214a	T	G	9: 75,010,150	L677R	probably damaging	Het
Fat3	T	C	9: 16,376,742	D495G	probably damaging	Het
Fsip2	T	C	2: 82,967,817	V485A	possibly damaging	Het
Gm14496	A	T	2: 181,997,476	H453L	possibly damaging	Het
Gm17027	T	C	14: 42,159,279	T207A	unknown	Het
Gm6902	T	G	7: 23,273,734	T123P	possibly damaging	Het
Gpat2	T	G	2: 127,432,435	W366G	possibly damaging	Het
Heatr6	A	T	11: 83,759,365	T216S	probably benign	Het
Hsd17b14	T	C	7: 45,556,076	V11A	probably damaging	Het
Jak2	T	A	19: 29,288,710	I517N	probably benign	Het
Kmt5b	G	A	19: 3,807,295	G351R	probably damaging	Het
Mau2	G	T	8: 70,031,516	Q141K	possibly damaging	Het
Mfsd13a	T	C	19: 46,367,866	F137L	probably damaging	Het
Mfsd13a	A	G	19: 46,372,265	H394R	probably benign	Het
Mfsd14b	A	T	13: 65,066,785	I451N	probably damaging	Het
Milr1	C	T	11: 106,757,711	H143Y	probably benign	Het
Mon2	T	G	10: 123,038,480	K321T	possibly damaging	Het
Nlrp9c	T	A	7: 26,371,322	N945Y	probably damaging	Het
Nwd2	A	G	5: 63,725,184	R60G	possibly damaging	Het
Olfr30	A	T	11: 58,455,568	I127N	probably damaging	Het
Olfr44	A	G	9: 39,484,752	V164A	probably benign	Het
Olfr691	T	C	7: 105,337,707	H3R	probably benign	Het
Papola	A	T	12: 105,812,307	I315L	possibly damaging	Het
Phf3	A	T	1: 30,805,023	S1618R	possibly damaging	Het
Phyhipl	A	G	10: 70,569,013	F77L	probably damaging	Het
Ppp3cb	A	G	14: 20,531,026	L110P	probably damaging	Het
Prss53	T	G	7: 127,886,575	E531A	probably benign	Het
Raf1	A	T	6: 115,631,341	H236Q	probably benign	Het
Ryr2	A	G	13: 11,595,643	V4099A	probably damaging	Het
Sfxn3	G	A	19: 45,049,915		probably null	Het
Sh3pxd2b	T	C	11: 32,415,978		probably null	Het
Slco6c1	C	T	1: 97,125,711	S155N	probably benign	Het
Speer4f2	A	G	5: 17,375,769	T115A	probably benign	Het
Spry1	T	C	3: 37,642,722	I38T	probably damaging	Het
Tagap	T	C	17: 7,933,714	V577A	probably benign	Het
Ubr4	C	A	4: 139,473,624	H4706Q	possibly damaging	Het
Vmn2r112	T	A	17: 22,601,179	L11Q	probably null	Het
Zfp60	T	C	7: 27,748,726	F273S	probably benign	Het
Zfp938	A	T	10: 82,225,398	Y463N	probably damaging	Het

Other mutations in Bmp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01637:Bmp1	APN	14	70492461	missense	probably damaging	1.00
IGL02065:Bmp1	APN	14	70486220	missense	probably damaging	0.97
IGL02065:Bmp1	APN	14	70490107	missense	probably damaging	0.99
IGL02349:Bmp1	APN	14	70507549	missense	possibly damaging	0.61
IGL02486:Bmp1	APN	14	70504776	missense	possibly damaging	0.48
PIT4519001:Bmp1	UTSW	14	70490029	missense	possibly damaging	0.65
R0394:Bmp1	UTSW	14	70490034	missense	probably damaging	0.99
R1371:Bmp1	UTSW	14	70492466	missense	probably damaging	1.00
R1604:Bmp1	UTSW	14	70508004	missense	possibly damaging	0.66
R1732:Bmp1	UTSW	14	70486265	missense	possibly damaging	0.67
R1834:Bmp1	UTSW	14	70508831	missense	possibly damaging	0.73
R2008:Bmp1	UTSW	14	70492466	missense	probably damaging	1.00
R2197:Bmp1	UTSW	14	70486272	missense	possibly damaging	0.83
R3157:Bmp1	UTSW	14	70492107	missense	possibly damaging	0.63
R4397:Bmp1	UTSW	14	70490542	splice site	probably null
R4609:Bmp1	UTSW	14	70477966	missense	probably benign	0.00
R4613:Bmp1	UTSW	14	70508523	missense	probably damaging	1.00
R4675:Bmp1	UTSW	14	70492844	missense	probably damaging	0.99
R4796:Bmp1	UTSW	14	70492073	splice site	probably null
R4884:Bmp1	UTSW	14	70475215	missense	probably benign	0.01
R4905:Bmp1	UTSW	14	70491362	missense	probably benign	0.06
R5088:Bmp1	UTSW	14	70486219	missense	possibly damaging	0.84
R5225:Bmp1	UTSW	14	70480165	missense	probably damaging	0.97
R5271:Bmp1	UTSW	14	70508128	missense	probably benign	0.34
R5625:Bmp1	UTSW	14	70486166	missense	probably benign	0.19
R5653:Bmp1	UTSW	14	70490094	missense	probably benign	0.00
R6155:Bmp1	UTSW	14	70508007	missense	probably damaging	1.00
R6295:Bmp1	UTSW	14	70491383	missense	possibly damaging	0.88
R6618:Bmp1	UTSW	14	70491368	missense	probably damaging	1.00
R6653:Bmp1	UTSW	14	70490618	missense	probably damaging	1.00
R6951:Bmp1	UTSW	14	70508858	missense	probably benign	0.26
R6983:Bmp1	UTSW	14	70508207	missense	probably damaging	0.96
R7207:Bmp1	UTSW	14	70479560	missense	possibly damaging	0.56
R7500:Bmp1	UTSW	14	70490122	missense	probably benign	0.44
R7716:Bmp1	UTSW	14	70477922	nonsense	probably null
R7749:Bmp1	UTSW	14	70492844	missense	probably damaging	1.00
R7763:Bmp1	UTSW	14	70492084	missense	probably damaging	1.00
R7834:Bmp1	UTSW	14	70508565	missense	probably damaging	1.00
R8232:Bmp1	UTSW	14	70519889	missense	probably damaging	0.97
R8490:Bmp1	UTSW	14	70490133	missense	possibly damaging	0.94
R8827:Bmp1	UTSW	14	70490642	missense	probably damaging	1.00
R8945:Bmp1	UTSW	14	70490190	missense	probably damaging	1.00
R9178:Bmp1	UTSW	14	70490173	missense	possibly damaging	0.78
R9228:Bmp1	UTSW	14	70519898	missense	probably benign
R9621:Bmp1	UTSW	14	70477866	missense	probably benign	0.29
R9652:Bmp1	UTSW	14	70477920	missense	probably damaging	1.00
X0028:Bmp1	UTSW	14	70508537	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGCCCTCTGAGCTTCTGTG -3'
(R):5'- CCCCATGCCTCCAAATTGTG -3'

Sequencing Primer
(F):5'- CCTCTGAGCTTCTGTGTACTGG -3'
(R):5'- GTGGTCCCACAGACTCACATCTC -3'

Posted On

2018-07-23