Incidental Mutation 'R6649:Bcdin3d'
ID 527709
Institutional Source Beutler Lab
Gene Symbol Bcdin3d
Ensembl Gene ENSMUSG00000037525
Gene Name BCDIN3 domain containing
Synonyms 4930556P03Rik
MMRRC Submission 044770-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.298) question?
Stock # R6649 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 99367965-99372611 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99368696 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 168 (T168A)
Ref Sequence ENSEMBL: ENSMUSP00000041809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040313]
AlphaFold Q91YP1
Predicted Effect probably damaging
Transcript: ENSMUST00000040313
AA Change: T168A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041809
Gene: ENSMUSG00000037525
AA Change: T168A

DomainStartEndE-ValueType
low complexity region 42 62 N/A INTRINSIC
Pfam:Methyltransf_18 70 216 3.2e-8 PFAM
Pfam:Bin3 159 265 7.3e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229827
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,800,941 (GRCm39) H627Q probably benign Het
Abra G A 15: 41,732,629 (GRCm39) L146F probably benign Het
Adamts7 T C 9: 90,073,990 (GRCm39) C857R probably damaging Het
Ankhd1 A T 18: 36,733,836 (GRCm39) probably null Het
Asb15 A G 6: 24,562,632 (GRCm39) N198S probably benign Het
Asb16 A T 11: 102,159,863 (GRCm39) Q72L possibly damaging Het
Atosa T G 9: 74,917,432 (GRCm39) L677R probably damaging Het
Bbox1 G T 2: 110,135,914 (GRCm39) H22N probably benign Het
Bmp1 A T 14: 70,728,058 (GRCm39) W624R probably damaging Het
Cdh18 A T 15: 23,436,620 (GRCm39) Y492F possibly damaging Het
Cep290 A C 10: 100,354,393 (GRCm39) D848A probably benign Het
Cip2a A T 16: 48,837,829 (GRCm39) Q843L probably damaging Het
Cmya5 G C 13: 93,234,533 (GRCm39) S185C possibly damaging Het
Cops9 C T 1: 92,568,136 (GRCm39) probably benign Het
Cutal C T 2: 34,775,933 (GRCm39) T88I probably benign Het
Dlg4 G T 11: 69,914,779 (GRCm39) probably benign Het
Dnah7c C A 1: 46,688,500 (GRCm39) T1890K probably benign Het
Dnah7c A G 1: 46,688,511 (GRCm39) S1894G probably benign Het
Eef2 CCC CCCC 10: 81,014,602 (GRCm39) probably null Het
Erp44 T C 4: 48,205,130 (GRCm39) I288V probably null Het
Fat3 T C 9: 16,288,038 (GRCm39) D495G probably damaging Het
Fsip2 T C 2: 82,798,161 (GRCm39) V485A possibly damaging Het
Gm14496 A T 2: 181,639,269 (GRCm39) H453L possibly damaging Het
Gm17027 T C 14: 41,981,236 (GRCm39) T207A unknown Het
Gm6902 T G 7: 22,973,159 (GRCm39) T123P possibly damaging Het
Gpat2 T G 2: 127,274,355 (GRCm39) W366G possibly damaging Het
Heatr6 A T 11: 83,650,191 (GRCm39) T216S probably benign Het
Hsd17b14 T C 7: 45,205,500 (GRCm39) V11A probably damaging Het
Jak2 T A 19: 29,266,110 (GRCm39) I517N probably benign Het
Kmt5b G A 19: 3,857,295 (GRCm39) G351R probably damaging Het
Mau2 G T 8: 70,484,166 (GRCm39) Q141K possibly damaging Het
Mfsd13a T C 19: 46,356,305 (GRCm39) F137L probably damaging Het
Mfsd13a A G 19: 46,360,704 (GRCm39) H394R probably benign Het
Mfsd14b A T 13: 65,214,599 (GRCm39) I451N probably damaging Het
Milr1 C T 11: 106,648,537 (GRCm39) H143Y probably benign Het
Mon2 T G 10: 122,874,385 (GRCm39) K321T possibly damaging Het
Nlrp9c T A 7: 26,070,747 (GRCm39) N945Y probably damaging Het
Nwd2 A G 5: 63,882,527 (GRCm39) R60G possibly damaging Het
Or2z2 A T 11: 58,346,394 (GRCm39) I127N probably damaging Het
Or52b2 T C 7: 104,986,914 (GRCm39) H3R probably benign Het
Or8g20 A G 9: 39,396,048 (GRCm39) V164A probably benign Het
Papola A T 12: 105,778,566 (GRCm39) I315L possibly damaging Het
Phf3 A T 1: 30,844,104 (GRCm39) S1618R possibly damaging Het
Phyhipl A G 10: 70,404,843 (GRCm39) F77L probably damaging Het
Ppp3cb A G 14: 20,581,094 (GRCm39) L110P probably damaging Het
Prss53 T G 7: 127,485,747 (GRCm39) E531A probably benign Het
Raf1 A T 6: 115,608,302 (GRCm39) H236Q probably benign Het
Ryr2 A G 13: 11,610,529 (GRCm39) V4099A probably damaging Het
Sfxn3 G A 19: 45,038,354 (GRCm39) probably null Het
Sh3pxd2b T C 11: 32,365,978 (GRCm39) probably null Het
Slco6c1 C T 1: 97,053,436 (GRCm39) S155N probably benign Het
Speer4f2 A G 5: 17,580,767 (GRCm39) T115A probably benign Het
Spry1 T C 3: 37,696,871 (GRCm39) I38T probably damaging Het
Tagap T C 17: 8,152,546 (GRCm39) V577A probably benign Het
Ubr4 C A 4: 139,200,935 (GRCm39) H4706Q possibly damaging Het
Vmn2r112 T A 17: 22,820,160 (GRCm39) L11Q probably null Het
Zfp60 T C 7: 27,448,151 (GRCm39) F273S probably benign Het
Zfp938 A T 10: 82,061,232 (GRCm39) Y463N probably damaging Het
Other mutations in Bcdin3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02642:Bcdin3d APN 15 99,368,673 (GRCm39) missense probably damaging 1.00
R0242:Bcdin3d UTSW 15 99,368,776 (GRCm39) missense probably benign
R0242:Bcdin3d UTSW 15 99,368,776 (GRCm39) missense probably benign
R0506:Bcdin3d UTSW 15 99,368,873 (GRCm39) missense probably damaging 1.00
R1724:Bcdin3d UTSW 15 99,368,561 (GRCm39) nonsense probably null
R4413:Bcdin3d UTSW 15 99,368,614 (GRCm39) missense probably damaging 1.00
R4673:Bcdin3d UTSW 15 99,368,719 (GRCm39) missense probably damaging 1.00
R5138:Bcdin3d UTSW 15 99,368,932 (GRCm39) missense possibly damaging 0.93
R5771:Bcdin3d UTSW 15 99,368,717 (GRCm39) missense probably benign 0.00
R6455:Bcdin3d UTSW 15 99,368,830 (GRCm39) missense probably benign
R6653:Bcdin3d UTSW 15 99,368,696 (GRCm39) missense probably damaging 1.00
R7214:Bcdin3d UTSW 15 99,368,344 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GATCTGCTTGGCCATGTCAC -3'
(R):5'- TGTGGCTCTGTACAAACATTTCC -3'

Sequencing Primer
(F):5'- TTGGCCATGTCACCTCGGATG -3'
(R):5'- ATCCTCTGCTGTGATATAGATCCAG -3'
Posted On 2018-07-23