Incidental Mutation 'R6650:Acsl3'
ID527722
Institutional Source Beutler Lab
Gene Symbol Acsl3
Ensembl Gene ENSMUSG00000032883
Gene Nameacyl-CoA synthetase long-chain family member 3
Synonyms2610510B12Rik, Facl3, C85929
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.689) question?
Stock #R6650 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location78657825-78707743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78681922 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 97 (N97S)
Ref Sequence ENSEMBL: ENSMUSP00000116576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035779] [ENSMUST00000134566] [ENSMUST00000135642] [ENSMUST00000142704]
Predicted Effect probably benign
Transcript: ENSMUST00000035779
AA Change: N97S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045291
Gene: ENSMUSG00000032883
AA Change: N97S

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132997
Predicted Effect probably benign
Transcript: ENSMUST00000134566
SMART Domains Protein: ENSMUSP00000117952
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
Pfam:AMP-binding 1 435 4.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135642
AA Change: N97S

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000116576
Gene: ENSMUSG00000032883
AA Change: N97S

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142704
AA Change: N97S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121695
Gene: ENSMUSG00000032883
AA Change: N97S

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2.5e-106 PFAM
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of the long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme is highly expressed in brain, and preferentially utilizes myristate, arachidonate, and eicosapentaenoate as substrates. The amino acid sequence of this isozyme is 92% identical to that of rat homolog. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice exhibit decreased blood percentages of CD4 T cells and B cells, and a decreased IgG1 response to ovalbumin. Male mutant mice exhibit growth retardation, reduced size and reduced total tissue and lean body mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aph1a T C 3: 95,896,286 V220A probably benign Het
Bin2 T A 15: 100,669,420 Q25L probably damaging Het
Ccdc102a T C 8: 94,913,264 E134G probably benign Het
Cdh6 A G 15: 13,051,401 V382A probably benign Het
Cep135 T A 5: 76,633,701 V845E possibly damaging Het
Cngb3 T C 4: 19,364,168 L124P probably damaging Het
Cped1 A G 6: 22,233,976 N725S probably damaging Het
Dcn C A 10: 97,507,743 N188K probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Ercc3 C T 18: 32,261,336 R590C probably damaging Het
Fchsd1 A T 18: 37,966,502 L213* probably null Het
Fmod A G 1: 134,041,007 S262G probably benign Het
Gm14548 T A 7: 3,895,633 Q272L probably benign Het
Gm15448 T A 7: 3,816,899 H555L possibly damaging Het
Gm45861 T C 8: 27,505,015 S530P unknown Het
Ifih1 T C 2: 62,606,447 D544G possibly damaging Het
Itpr1 A G 6: 108,394,073 probably null Het
Larp1 CA CAA 11: 58,058,596 probably null Het
Lbp T A 2: 158,309,667 S102R probably benign Het
Lepr C A 4: 101,815,201 Q1141K probably damaging Het
Mcm8 C A 2: 132,821,407 N148K probably benign Het
Mcpt4 T G 14: 56,060,633 T154P possibly damaging Het
Mrpl22 A G 11: 58,175,308 Y76C probably damaging Het
Msln T C 17: 25,750,170 I414V probably benign Het
Ncor1 G A 11: 62,334,541 T1798I probably damaging Het
Nlrp4c T A 7: 6,065,949 F283Y probably damaging Het
Os9 C T 10: 127,100,084 probably null Het
Pja2 T C 17: 64,292,941 E516G probably damaging Het
Pofut1 T A 2: 153,259,350 probably benign Het
Prl2b1 G T 13: 27,385,266 H116Q probably benign Het
Ralgapa2 T C 2: 146,388,502 K1048E probably damaging Het
Scnn1b G A 7: 121,902,820 V234M probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Sh3pxd2a C T 19: 47,268,224 G685D probably benign Het
Six4 C A 12: 73,103,525 G749C probably benign Het
Tnn G A 1: 160,114,583 T1115I probably damaging Het
Tpcn1 T A 5: 120,537,562 Q779L probably null Het
Ugt2a2 A G 5: 87,474,600 Y380H probably damaging Het
Xkr8 T C 4: 132,727,938 T375A probably benign Het
Zdhhc20 T A 14: 57,858,575 K135N probably damaging Het
Zfp235 T A 7: 24,137,038 probably null Het
Zfp354c A G 11: 50,814,691 V519A probably damaging Het
Other mutations in Acsl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Acsl3 APN 1 78699759 missense possibly damaging 0.79
IGL02201:Acsl3 APN 1 78699153 missense probably damaging 1.00
IGL03162:Acsl3 APN 1 78699170 critical splice donor site probably null
R0601:Acsl3 UTSW 1 78696179 missense probably damaging 1.00
R0658:Acsl3 UTSW 1 78701287 missense probably damaging 1.00
R1389:Acsl3 UTSW 1 78688282 missense probably benign
R1468:Acsl3 UTSW 1 78706409 missense probably benign 0.03
R1468:Acsl3 UTSW 1 78706409 missense probably benign 0.03
R1697:Acsl3 UTSW 1 78705397 splice site probably benign
R2083:Acsl3 UTSW 1 78699811 missense probably damaging 0.99
R2125:Acsl3 UTSW 1 78681961 missense probably damaging 0.97
R2191:Acsl3 UTSW 1 78699140 missense probably damaging 1.00
R2299:Acsl3 UTSW 1 78699110 missense probably damaging 1.00
R2395:Acsl3 UTSW 1 78705368 missense probably benign 0.00
R2964:Acsl3 UTSW 1 78694294 missense probably benign 0.01
R3403:Acsl3 UTSW 1 78696122 missense probably damaging 1.00
R4655:Acsl3 UTSW 1 78690346 missense probably damaging 1.00
R5537:Acsl3 UTSW 1 78706356 missense probably damaging 1.00
R5823:Acsl3 UTSW 1 78688286 missense probably benign
R6239:Acsl3 UTSW 1 78696465 missense probably benign 0.00
R6376:Acsl3 UTSW 1 78696465 missense possibly damaging 0.81
R7031:Acsl3 UTSW 1 78688283 missense probably benign
R7282:Acsl3 UTSW 1 78681992 missense probably damaging 0.97
R7733:Acsl3 UTSW 1 78688236 critical splice acceptor site probably null
R7891:Acsl3 UTSW 1 78703588 missense probably benign 0.02
R7974:Acsl3 UTSW 1 78703588 missense probably benign 0.02
R7998:Acsl3 UTSW 1 78694271 missense probably damaging 1.00
R8056:Acsl3 UTSW 1 78681894 missense probably damaging 1.00
X0025:Acsl3 UTSW 1 78692202 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTATCTTCAACACCATCAACCATG -3'
(R):5'- CCCAGGTACAGGAGACCACA -3'

Sequencing Primer
(F):5'- ACCATCAACCATGAAGCTAAAAC -3'
(R):5'- GGTACAGGAGACCACACTTCC -3'
Posted On2018-07-23