Incidental Mutation 'R6650:Aph1a'
ID527730
Institutional Source Beutler Lab
Gene Symbol Aph1a
Ensembl Gene ENSMUSG00000015750
Gene Nameaph1 homolog A, gamma secretase subunit
Synonyms6530402N02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6650 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location95893969-95898288 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95896286 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 220 (V220A)
Ref Sequence ENSEMBL: ENSMUSP00000058846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015894] [ENSMUST00000036181] [ENSMUST00000036360] [ENSMUST00000056710] [ENSMUST00000090476] [ENSMUST00000147962] [ENSMUST00000171519] [ENSMUST00000197081]
Predicted Effect probably benign
Transcript: ENSMUST00000015894
AA Change: V220A

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000015894
Gene: ENSMUSG00000015750
AA Change: V220A

DomainStartEndE-ValueType
Pfam:Aph-1 2 246 7.3e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036181
SMART Domains Protein: ENSMUSP00000036983
Gene: ENSMUSG00000038526

DomainStartEndE-ValueType
Carb_anhydrase 22 278 2.43e-123 SMART
transmembrane domain 290 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036360
SMART Domains Protein: ENSMUSP00000046810
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 145 3.6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056710
AA Change: V220A

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000058846
Gene: ENSMUSG00000015750
AA Change: V220A

DomainStartEndE-ValueType
Pfam:Aph-1 2 239 1.2e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090476
SMART Domains Protein: ENSMUSP00000102749
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 146 1.8e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145949
Predicted Effect probably benign
Transcript: ENSMUST00000147962
SMART Domains Protein: ENSMUSP00000117464
Gene: ENSMUSG00000038526

DomainStartEndE-ValueType
Carb_anhydrase 8 171 1.79e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171519
SMART Domains Protein: ENSMUSP00000127666
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 146 1.5e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197232
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: This gene encodes a subunit of the gamma-secretase complex, which is localized to the endoplasmic reticulum and golgi apparatus. Gamma-secretase is a multi-protein enzyme that catalyzes intramembraneous proteolysis of type I transmembrane proteins and is essential for many signaling pathways, including the Notch signaling pathway. Studies suggest that the protein encoded by this locus binds directly to substrates of the gamma-secretase complex, including the beta-amyloid precursor protein which is associated with Alzheimer disease progression. This gene is required for normal embryonic development and survival, and disruption is associated with defects in the yolk sack angiogenesis, neural tube formation, and somitogenesis. A pseudogene of this gene is located on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous null embryos die by E11, are severely growth retarded by E9.5 and display defects in somite patterning, branchial arch and heart chamber development, vascular morphogenesis of the yolk sac and have distended pericardial sacs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,681,922 N97S probably benign Het
Bin2 T A 15: 100,669,420 Q25L probably damaging Het
Ccdc102a T C 8: 94,913,264 E134G probably benign Het
Cdh6 A G 15: 13,051,401 V382A probably benign Het
Cep135 T A 5: 76,633,701 V845E possibly damaging Het
Cngb3 T C 4: 19,364,168 L124P probably damaging Het
Cped1 A G 6: 22,233,976 N725S probably damaging Het
Dcn C A 10: 97,507,743 N188K probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Ercc3 C T 18: 32,261,336 R590C probably damaging Het
Fchsd1 A T 18: 37,966,502 L213* probably null Het
Fmod A G 1: 134,041,007 S262G probably benign Het
Gm14548 T A 7: 3,895,633 Q272L probably benign Het
Gm15448 T A 7: 3,816,899 H555L possibly damaging Het
Gm45861 T C 8: 27,505,015 S530P unknown Het
Ifih1 T C 2: 62,606,447 D544G possibly damaging Het
Itpr1 A G 6: 108,394,073 probably null Het
Larp1 CA CAA 11: 58,058,596 probably null Het
Lbp T A 2: 158,309,667 S102R probably benign Het
Lepr C A 4: 101,815,201 Q1141K probably damaging Het
Mcm8 C A 2: 132,821,407 N148K probably benign Het
Mcpt4 T G 14: 56,060,633 T154P possibly damaging Het
Mrpl22 A G 11: 58,175,308 Y76C probably damaging Het
Msln T C 17: 25,750,170 I414V probably benign Het
Ncor1 G A 11: 62,334,541 T1798I probably damaging Het
Nlrp4c T A 7: 6,065,949 F283Y probably damaging Het
Os9 C T 10: 127,100,084 probably null Het
Pja2 T C 17: 64,292,941 E516G probably damaging Het
Pofut1 T A 2: 153,259,350 probably benign Het
Prl2b1 G T 13: 27,385,266 H116Q probably benign Het
Ralgapa2 T C 2: 146,388,502 K1048E probably damaging Het
Scnn1b G A 7: 121,902,820 V234M probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Sh3pxd2a C T 19: 47,268,224 G685D probably benign Het
Six4 C A 12: 73,103,525 G749C probably benign Het
Tnn G A 1: 160,114,583 T1115I probably damaging Het
Tpcn1 T A 5: 120,537,562 Q779L probably null Het
Ugt2a2 A G 5: 87,474,600 Y380H probably damaging Het
Xkr8 T C 4: 132,727,938 T375A probably benign Het
Zdhhc20 T A 14: 57,858,575 K135N probably damaging Het
Zfp235 T A 7: 24,137,038 probably null Het
Zfp354c A G 11: 50,814,691 V519A probably damaging Het
Other mutations in Aph1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02103:Aph1a APN 3 95895813 missense probably damaging 0.99
R1675:Aph1a UTSW 3 95894899 missense possibly damaging 0.96
R1735:Aph1a UTSW 3 95895509 missense probably damaging 1.00
R1872:Aph1a UTSW 3 95895564 missense probably damaging 1.00
R2356:Aph1a UTSW 3 95894232 missense probably benign 0.24
R3942:Aph1a UTSW 3 95894261 missense probably damaging 1.00
R4654:Aph1a UTSW 3 95895776 missense probably benign 0.01
R4989:Aph1a UTSW 3 95895531 missense probably damaging 1.00
R5134:Aph1a UTSW 3 95895531 missense probably damaging 1.00
R5184:Aph1a UTSW 3 95895739 unclassified probably null
R6603:Aph1a UTSW 3 95895496 missense probably damaging 1.00
R8157:Aph1a UTSW 3 95894838 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TGCTTGAAGGGAAACAGGTTTC -3'
(R):5'- GGTCACAAATGGACAACGCC -3'

Sequencing Primer
(F):5'- TTCTGAATGAGATGTCTGAGCAAG -3'
(R):5'- AAGCGGGGCACATCAGC -3'
Posted On2018-07-23