Mutagenetix > Incidental Mutations

Incidental Mutation 'R6650:Cep135'

527734

Institutional Source

Beutler Lab

Gene Symbol

Cep135

Ensembl Gene

ENSMUSG00000036403

Gene Name

centrosomal protein 135

Synonyms

LOC381644, Cep4

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6650 (G1)

Quality Score

209.009

Status

Validated

Chromosome

Chromosomal Location

76588698-76646466 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 76633701 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 845 (V845E)

Ref Sequence

ENSEMBL: ENSMUSP00000112602 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049060] [ENSMUST00000121979]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000049060
AA Change: V845E

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000038674
Gene: ENSMUSG00000036403
AA Change: V845E

Domain	Start	End	E-Value	Type
internal_repeat_1	47	71	1.87e-5	PROSPERO
low complexity region	78	92	N/A	INTRINSIC
internal_repeat_1	100	124	1.87e-5	PROSPERO
coiled coil region	125	153	N/A	INTRINSIC
coiled coil region	194	245	N/A	INTRINSIC
coiled coil region	267	420	N/A	INTRINSIC
coiled coil region	445	470	N/A	INTRINSIC
Blast:HAMP	492	527	5e-11	BLAST
Blast:SPEC	760	863	6e-21	BLAST
low complexity region	1060	1072	N/A	INTRINSIC
coiled coil region	1075	1117	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121979
AA Change: V845E

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000112602
Gene: ENSMUSG00000036403
AA Change: V845E

Domain	Start	End	E-Value	Type
internal_repeat_1	47	71	1.87e-5	PROSPERO
low complexity region	78	92	N/A	INTRINSIC
internal_repeat_1	100	124	1.87e-5	PROSPERO
coiled coil region	125	153	N/A	INTRINSIC
coiled coil region	194	245	N/A	INTRINSIC
coiled coil region	267	420	N/A	INTRINSIC
coiled coil region	445	470	N/A	INTRINSIC
Blast:HAMP	492	527	5e-11	BLAST
Blast:SPEC	760	863	6e-21	BLAST
low complexity region	1060	1072	N/A	INTRINSIC
coiled coil region	1075	1117	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130651

Meta Mutation Damage Score

0.1000

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein, which acts as a scaffolding protein during early centriole biogenesis, and is also required for centriole-centriole cohesion during interphase. Mutations in this gene are associated with autosomal recessive primary microcephaly-8. [provided by RefSeq, Jun 2012]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl3	A	G	1: 78,681,922	N97S	probably benign	Het
Aph1a	T	C	3: 95,896,286	V220A	probably benign	Het
Bin2	T	A	15: 100,669,420	Q25L	probably damaging	Het
Ccdc102a	T	C	8: 94,913,264	E134G	probably benign	Het
Cdh6	A	G	15: 13,051,401	V382A	probably benign	Het
Cngb3	T	C	4: 19,364,168	L124P	probably damaging	Het
Cped1	A	G	6: 22,233,976	N725S	probably damaging	Het
Dcn	C	A	10: 97,507,743	N188K	probably benign	Het
Dnah7c	C	A	1: 46,649,340	T1890K	probably benign	Het
Dnah7c	A	G	1: 46,649,351	S1894G	probably benign	Het
Eef2	CCC	CCCC	10: 81,178,768		probably null	Het
Ercc3	C	T	18: 32,261,336	R590C	probably damaging	Het
Fchsd1	A	T	18: 37,966,502	L213*	probably null	Het
Fmod	A	G	1: 134,041,007	S262G	probably benign	Het
Gm14548	T	A	7: 3,895,633	Q272L	probably benign	Het
Gm15448	T	A	7: 3,816,899	H555L	possibly damaging	Het
Gm45861	T	C	8: 27,505,015	S530P	unknown	Het
Ifih1	T	C	2: 62,606,447	D544G	possibly damaging	Het
Itpr1	A	G	6: 108,394,073		probably null	Het
Larp1	CA	CAA	11: 58,058,596		probably null	Het
Lbp	T	A	2: 158,309,667	S102R	probably benign	Het
Lepr	C	A	4: 101,815,201	Q1141K	probably damaging	Het
Mcm8	C	A	2: 132,821,407	N148K	probably benign	Het
Mcpt4	T	G	14: 56,060,633	T154P	possibly damaging	Het
Mrpl22	A	G	11: 58,175,308	Y76C	probably damaging	Het
Msln	T	C	17: 25,750,170	I414V	probably benign	Het
Ncor1	G	A	11: 62,334,541	T1798I	probably damaging	Het
Nlrp4c	T	A	7: 6,065,949	F283Y	probably damaging	Het
Os9	C	T	10: 127,100,084		probably null	Het
Pja2	T	C	17: 64,292,941	E516G	probably damaging	Het
Pofut1	T	A	2: 153,259,350		probably benign	Het
Prl2b1	G	T	13: 27,385,266	H116Q	probably benign	Het
Ralgapa2	T	C	2: 146,388,502	K1048E	probably damaging	Het
Scnn1b	G	A	7: 121,902,820	V234M	probably damaging	Het
Sfxn3	G	A	19: 45,049,915		probably null	Het
Sh3pxd2a	C	T	19: 47,268,224	G685D	probably benign	Het
Six4	C	A	12: 73,103,525	G749C	probably benign	Het
Tnn	G	A	1: 160,114,583	T1115I	probably damaging	Het
Tpcn1	T	A	5: 120,537,562	Q779L	probably null	Het
Ugt2a2	A	G	5: 87,474,600	Y380H	probably damaging	Het
Xkr8	T	C	4: 132,727,938	T375A	probably benign	Het
Zdhhc20	T	A	14: 57,858,575	K135N	probably damaging	Het
Zfp235	T	A	7: 24,137,038		probably null	Het
Zfp354c	A	G	11: 50,814,691	V519A	probably damaging	Het

Other mutations in Cep135

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Cep135	APN	5	76601459	missense	probably damaging	0.98
IGL01154:Cep135	APN	5	76606796	splice site	probably benign
IGL01323:Cep135	APN	5	76591765	missense	probably benign	0.29
IGL01599:Cep135	APN	5	76593347	missense	possibly damaging	0.93
IGL01923:Cep135	APN	5	76640982	makesense	probably null
IGL02178:Cep135	APN	5	76595474	missense	probably damaging	1.00
IGL02276:Cep135	APN	5	76634246	missense	probably benign	0.00
IGL02344:Cep135	APN	5	76616821	missense	probably benign
IGL02394:Cep135	APN	5	76631471	missense	probably benign	0.02
IGL02740:Cep135	APN	5	76638268	critical splice donor site	probably null
IGL02832:Cep135	APN	5	76640949	missense	probably damaging	0.98
R0026:Cep135	UTSW	5	76606734	nonsense	probably null
R0060:Cep135	UTSW	5	76621350	missense	probably benign	0.20
R0325:Cep135	UTSW	5	76615743	missense	probably damaging	0.98
R0336:Cep135	UTSW	5	76601502	missense	probably benign	0.07
R0564:Cep135	UTSW	5	76615710	missense	probably damaging	1.00
R0564:Cep135	UTSW	5	76638949	missense	probably benign	0.03
R0600:Cep135	UTSW	5	76621305	missense	probably benign
R0636:Cep135	UTSW	5	76615657	missense	probably benign	0.07
R0704:Cep135	UTSW	5	76630949	missense	possibly damaging	0.62
R0835:Cep135	UTSW	5	76615706	missense	probably benign	0.40
R1015:Cep135	UTSW	5	76640997	critical splice donor site	probably null
R1167:Cep135	UTSW	5	76624637	missense	probably damaging	1.00
R1252:Cep135	UTSW	5	76594115	missense	possibly damaging	0.67
R1554:Cep135	UTSW	5	76634213	nonsense	probably null
R1770:Cep135	UTSW	5	76603195	missense	possibly damaging	0.95
R1804:Cep135	UTSW	5	76636932	missense	probably benign	0.22
R1968:Cep135	UTSW	5	76624747	missense	possibly damaging	0.96
R1987:Cep135	UTSW	5	76597428	missense	probably benign	0.00
R1996:Cep135	UTSW	5	76632266	missense	probably benign	0.08
R2004:Cep135	UTSW	5	76632329	critical splice donor site	probably null
R2178:Cep135	UTSW	5	76631450	missense	probably benign	0.00
R2305:Cep135	UTSW	5	76595389	splice site	probably benign
R2679:Cep135	UTSW	5	76624660	missense	probably benign
R3125:Cep135	UTSW	5	76621363	critical splice donor site	probably null
R3623:Cep135	UTSW	5	76624739	missense	probably benign	0.00
R4359:Cep135	UTSW	5	76611714	missense	possibly damaging	0.47
R4407:Cep135	UTSW	5	76624667	missense	probably benign
R4561:Cep135	UTSW	5	76638193	missense	possibly damaging	0.95
R4666:Cep135	UTSW	5	76616854	missense	probably benign
R4945:Cep135	UTSW	5	76597428	missense	probably benign	0.00
R5105:Cep135	UTSW	5	76594092	missense	probably benign	0.00
R5117:Cep135	UTSW	5	76631429	missense	probably benign	0.01
R5176:Cep135	UTSW	5	76637026	missense	probably benign	0.04
R5194:Cep135	UTSW	5	76615777	missense	probably benign	0.05
R5233:Cep135	UTSW	5	76591843	small deletion	probably benign
R5275:Cep135	UTSW	5	76593204	missense	possibly damaging	0.94
R5295:Cep135	UTSW	5	76593204	missense	possibly damaging	0.94
R5412:Cep135	UTSW	5	76616862	missense	probably benign	0.00
R5427:Cep135	UTSW	5	76638202	missense	probably benign	0.00
R5801:Cep135	UTSW	5	76630676	missense	probably damaging	1.00
R5975:Cep135	UTSW	5	76640890	missense	possibly damaging	0.94
R6087:Cep135	UTSW	5	76615791	critical splice donor site	probably null
R6176:Cep135	UTSW	5	76624643	missense	probably benign
R6210:Cep135	UTSW	5	76624723	missense	probably benign	0.15
R6456:Cep135	UTSW	5	76591724	start gained	probably benign
R6467:Cep135	UTSW	5	76621340	missense	possibly damaging	0.50
R6622:Cep135	UTSW	5	76640968	missense	probably benign	0.00
R6838:Cep135	UTSW	5	76632215	missense	probably damaging	1.00
R7028:Cep135	UTSW	5	76616848	missense	probably benign
R7049:Cep135	UTSW	5	76606738	missense	probably benign	0.01
R7095:Cep135	UTSW	5	76594058	missense	probably benign	0.10
R7207:Cep135	UTSW	5	76632243	missense	probably benign	0.00
R7330:Cep135	UTSW	5	76606745	nonsense	probably null
R7369:Cep135	UTSW	5	76593253	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- CGCCTATGTATATATGCGTTCAC -3'
(R):5'- CGCAATATTTAAGGCTGGAGGC -3'

Sequencing Primer
(F):5'- GTATATATGCGTTCACTGCACACAC -3'
(R):5'- TTTAAGGCTGGAGGCAGAATTAAAG -3'

Posted On

2018-07-23