Incidental Mutation 'R6650:Cep135'
ID527734
Institutional Source Beutler Lab
Gene Symbol Cep135
Ensembl Gene ENSMUSG00000036403
Gene Namecentrosomal protein 135
SynonymsLOC381644, Cep4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6650 (G1)
Quality Score209.009
Status Validated
Chromosome5
Chromosomal Location76588698-76646466 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76633701 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 845 (V845E)
Ref Sequence ENSEMBL: ENSMUSP00000112602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049060] [ENSMUST00000121979]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049060
AA Change: V845E

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038674
Gene: ENSMUSG00000036403
AA Change: V845E

DomainStartEndE-ValueType
internal_repeat_1 47 71 1.87e-5 PROSPERO
low complexity region 78 92 N/A INTRINSIC
internal_repeat_1 100 124 1.87e-5 PROSPERO
coiled coil region 125 153 N/A INTRINSIC
coiled coil region 194 245 N/A INTRINSIC
coiled coil region 267 420 N/A INTRINSIC
coiled coil region 445 470 N/A INTRINSIC
Blast:HAMP 492 527 5e-11 BLAST
Blast:SPEC 760 863 6e-21 BLAST
low complexity region 1060 1072 N/A INTRINSIC
coiled coil region 1075 1117 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121979
AA Change: V845E

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112602
Gene: ENSMUSG00000036403
AA Change: V845E

DomainStartEndE-ValueType
internal_repeat_1 47 71 1.87e-5 PROSPERO
low complexity region 78 92 N/A INTRINSIC
internal_repeat_1 100 124 1.87e-5 PROSPERO
coiled coil region 125 153 N/A INTRINSIC
coiled coil region 194 245 N/A INTRINSIC
coiled coil region 267 420 N/A INTRINSIC
coiled coil region 445 470 N/A INTRINSIC
Blast:HAMP 492 527 5e-11 BLAST
Blast:SPEC 760 863 6e-21 BLAST
low complexity region 1060 1072 N/A INTRINSIC
coiled coil region 1075 1117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130651
Meta Mutation Damage Score 0.1000 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein, which acts as a scaffolding protein during early centriole biogenesis, and is also required for centriole-centriole cohesion during interphase. Mutations in this gene are associated with autosomal recessive primary microcephaly-8. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,681,922 N97S probably benign Het
Aph1a T C 3: 95,896,286 V220A probably benign Het
Bin2 T A 15: 100,669,420 Q25L probably damaging Het
Ccdc102a T C 8: 94,913,264 E134G probably benign Het
Cdh6 A G 15: 13,051,401 V382A probably benign Het
Cngb3 T C 4: 19,364,168 L124P probably damaging Het
Cped1 A G 6: 22,233,976 N725S probably damaging Het
Dcn C A 10: 97,507,743 N188K probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Ercc3 C T 18: 32,261,336 R590C probably damaging Het
Fchsd1 A T 18: 37,966,502 L213* probably null Het
Fmod A G 1: 134,041,007 S262G probably benign Het
Gm14548 T A 7: 3,895,633 Q272L probably benign Het
Gm15448 T A 7: 3,816,899 H555L possibly damaging Het
Gm45861 T C 8: 27,505,015 S530P unknown Het
Ifih1 T C 2: 62,606,447 D544G possibly damaging Het
Itpr1 A G 6: 108,394,073 probably null Het
Larp1 CA CAA 11: 58,058,596 probably null Het
Lbp T A 2: 158,309,667 S102R probably benign Het
Lepr C A 4: 101,815,201 Q1141K probably damaging Het
Mcm8 C A 2: 132,821,407 N148K probably benign Het
Mcpt4 T G 14: 56,060,633 T154P possibly damaging Het
Mrpl22 A G 11: 58,175,308 Y76C probably damaging Het
Msln T C 17: 25,750,170 I414V probably benign Het
Ncor1 G A 11: 62,334,541 T1798I probably damaging Het
Nlrp4c T A 7: 6,065,949 F283Y probably damaging Het
Os9 C T 10: 127,100,084 probably null Het
Pja2 T C 17: 64,292,941 E516G probably damaging Het
Pofut1 T A 2: 153,259,350 probably benign Het
Prl2b1 G T 13: 27,385,266 H116Q probably benign Het
Ralgapa2 T C 2: 146,388,502 K1048E probably damaging Het
Scnn1b G A 7: 121,902,820 V234M probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Sh3pxd2a C T 19: 47,268,224 G685D probably benign Het
Six4 C A 12: 73,103,525 G749C probably benign Het
Tnn G A 1: 160,114,583 T1115I probably damaging Het
Tpcn1 T A 5: 120,537,562 Q779L probably null Het
Ugt2a2 A G 5: 87,474,600 Y380H probably damaging Het
Xkr8 T C 4: 132,727,938 T375A probably benign Het
Zdhhc20 T A 14: 57,858,575 K135N probably damaging Het
Zfp235 T A 7: 24,137,038 probably null Het
Zfp354c A G 11: 50,814,691 V519A probably damaging Het
Other mutations in Cep135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Cep135 APN 5 76601459 missense probably damaging 0.98
IGL01154:Cep135 APN 5 76606796 splice site probably benign
IGL01323:Cep135 APN 5 76591765 missense probably benign 0.29
IGL01599:Cep135 APN 5 76593347 missense possibly damaging 0.93
IGL01923:Cep135 APN 5 76640982 makesense probably null
IGL02178:Cep135 APN 5 76595474 missense probably damaging 1.00
IGL02276:Cep135 APN 5 76634246 missense probably benign 0.00
IGL02344:Cep135 APN 5 76616821 missense probably benign
IGL02394:Cep135 APN 5 76631471 missense probably benign 0.02
IGL02740:Cep135 APN 5 76638268 critical splice donor site probably null
IGL02832:Cep135 APN 5 76640949 missense probably damaging 0.98
R0026:Cep135 UTSW 5 76606734 nonsense probably null
R0060:Cep135 UTSW 5 76621350 missense probably benign 0.20
R0325:Cep135 UTSW 5 76615743 missense probably damaging 0.98
R0336:Cep135 UTSW 5 76601502 missense probably benign 0.07
R0564:Cep135 UTSW 5 76615710 missense probably damaging 1.00
R0564:Cep135 UTSW 5 76638949 missense probably benign 0.03
R0600:Cep135 UTSW 5 76621305 missense probably benign
R0636:Cep135 UTSW 5 76615657 missense probably benign 0.07
R0704:Cep135 UTSW 5 76630949 missense possibly damaging 0.62
R0835:Cep135 UTSW 5 76615706 missense probably benign 0.40
R1015:Cep135 UTSW 5 76640997 critical splice donor site probably null
R1167:Cep135 UTSW 5 76624637 missense probably damaging 1.00
R1252:Cep135 UTSW 5 76594115 missense possibly damaging 0.67
R1554:Cep135 UTSW 5 76634213 nonsense probably null
R1770:Cep135 UTSW 5 76603195 missense possibly damaging 0.95
R1804:Cep135 UTSW 5 76636932 missense probably benign 0.22
R1968:Cep135 UTSW 5 76624747 missense possibly damaging 0.96
R1987:Cep135 UTSW 5 76597428 missense probably benign 0.00
R1996:Cep135 UTSW 5 76632266 missense probably benign 0.08
R2004:Cep135 UTSW 5 76632329 critical splice donor site probably null
R2178:Cep135 UTSW 5 76631450 missense probably benign 0.00
R2305:Cep135 UTSW 5 76595389 splice site probably benign
R2679:Cep135 UTSW 5 76624660 missense probably benign
R3125:Cep135 UTSW 5 76621363 critical splice donor site probably null
R3623:Cep135 UTSW 5 76624739 missense probably benign 0.00
R4359:Cep135 UTSW 5 76611714 missense possibly damaging 0.47
R4407:Cep135 UTSW 5 76624667 missense probably benign
R4561:Cep135 UTSW 5 76638193 missense possibly damaging 0.95
R4666:Cep135 UTSW 5 76616854 missense probably benign
R4945:Cep135 UTSW 5 76597428 missense probably benign 0.00
R5105:Cep135 UTSW 5 76594092 missense probably benign 0.00
R5117:Cep135 UTSW 5 76631429 missense probably benign 0.01
R5176:Cep135 UTSW 5 76637026 missense probably benign 0.04
R5194:Cep135 UTSW 5 76615777 missense probably benign 0.05
R5233:Cep135 UTSW 5 76591843 small deletion probably benign
R5275:Cep135 UTSW 5 76593204 missense possibly damaging 0.94
R5295:Cep135 UTSW 5 76593204 missense possibly damaging 0.94
R5412:Cep135 UTSW 5 76616862 missense probably benign 0.00
R5427:Cep135 UTSW 5 76638202 missense probably benign 0.00
R5801:Cep135 UTSW 5 76630676 missense probably damaging 1.00
R5975:Cep135 UTSW 5 76640890 missense possibly damaging 0.94
R6087:Cep135 UTSW 5 76615791 critical splice donor site probably null
R6176:Cep135 UTSW 5 76624643 missense probably benign
R6210:Cep135 UTSW 5 76624723 missense probably benign 0.15
R6456:Cep135 UTSW 5 76591724 start gained probably benign
R6467:Cep135 UTSW 5 76621340 missense possibly damaging 0.50
R6622:Cep135 UTSW 5 76640968 missense probably benign 0.00
R6838:Cep135 UTSW 5 76632215 missense probably damaging 1.00
R7028:Cep135 UTSW 5 76616848 missense probably benign
R7049:Cep135 UTSW 5 76606738 missense probably benign 0.01
R7095:Cep135 UTSW 5 76594058 missense probably benign 0.10
R7207:Cep135 UTSW 5 76632243 missense probably benign 0.00
R7330:Cep135 UTSW 5 76606745 nonsense probably null
R7369:Cep135 UTSW 5 76593253 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CGCCTATGTATATATGCGTTCAC -3'
(R):5'- CGCAATATTTAAGGCTGGAGGC -3'

Sequencing Primer
(F):5'- GTATATATGCGTTCACTGCACACAC -3'
(R):5'- TTTAAGGCTGGAGGCAGAATTAAAG -3'
Posted On2018-07-23