Incidental Mutation 'R6650:Zfp235'
ID527742
Institutional Source Beutler Lab
Gene Symbol Zfp235
Ensembl Gene ENSMUSG00000047603
Gene Namezinc finger protein 235
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6650 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location24134169-24143241 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 24137038 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056549] [ENSMUST00000205680]
Predicted Effect probably null
Transcript: ENSMUST00000056549
SMART Domains Protein: ENSMUSP00000050803
Gene: ENSMUSG00000047603

DomainStartEndE-ValueType
KRAB 8 71 1.09e-15 SMART
ZnF_C2H2 283 305 1.79e-2 SMART
ZnF_C2H2 311 333 3.16e-3 SMART
ZnF_C2H2 339 361 1.18e-2 SMART
ZnF_C2H2 367 389 6.99e-5 SMART
ZnF_C2H2 395 417 1.33e-1 SMART
ZnF_C2H2 423 445 3.16e-3 SMART
ZnF_C2H2 451 473 2.84e-5 SMART
ZnF_C2H2 479 501 6.32e-3 SMART
ZnF_C2H2 507 529 3.44e-4 SMART
ZnF_C2H2 535 557 2.12e-4 SMART
ZnF_C2H2 563 585 1.38e-3 SMART
ZnF_C2H2 591 613 2.27e-4 SMART
ZnF_C2H2 619 641 5.99e-4 SMART
ZnF_C2H2 647 669 5.9e-3 SMART
ZnF_C2H2 675 697 4.87e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000205680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206809
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the zinc finger protein superfamily, members of which are regulatory proteins characterized by nucleic acid-binding zinc finger domains. The encoded protein is a member of the Kruppel family of zinc finger proteins, and contains Kruppel-associated box (KRAB) A and B domains and 15 tandemly arrayed C2H2-type zinc fingers. It is an ortholog of the mouse Zfp93 protein. This gene is located in a cluster of zinc finger genes on 19q13.2. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,681,922 N97S probably benign Het
Aph1a T C 3: 95,896,286 V220A probably benign Het
Bin2 T A 15: 100,669,420 Q25L probably damaging Het
Ccdc102a T C 8: 94,913,264 E134G probably benign Het
Cdh6 A G 15: 13,051,401 V382A probably benign Het
Cep135 T A 5: 76,633,701 V845E possibly damaging Het
Cngb3 T C 4: 19,364,168 L124P probably damaging Het
Cped1 A G 6: 22,233,976 N725S probably damaging Het
Dcn C A 10: 97,507,743 N188K probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Ercc3 C T 18: 32,261,336 R590C probably damaging Het
Fchsd1 A T 18: 37,966,502 L213* probably null Het
Fmod A G 1: 134,041,007 S262G probably benign Het
Gm14548 T A 7: 3,895,633 Q272L probably benign Het
Gm15448 T A 7: 3,816,899 H555L possibly damaging Het
Gm45861 T C 8: 27,505,015 S530P unknown Het
Ifih1 T C 2: 62,606,447 D544G possibly damaging Het
Itpr1 A G 6: 108,394,073 probably null Het
Larp1 CA CAA 11: 58,058,596 probably null Het
Lbp T A 2: 158,309,667 S102R probably benign Het
Lepr C A 4: 101,815,201 Q1141K probably damaging Het
Mcm8 C A 2: 132,821,407 N148K probably benign Het
Mcpt4 T G 14: 56,060,633 T154P possibly damaging Het
Mrpl22 A G 11: 58,175,308 Y76C probably damaging Het
Msln T C 17: 25,750,170 I414V probably benign Het
Ncor1 G A 11: 62,334,541 T1798I probably damaging Het
Nlrp4c T A 7: 6,065,949 F283Y probably damaging Het
Os9 C T 10: 127,100,084 probably null Het
Pja2 T C 17: 64,292,941 E516G probably damaging Het
Pofut1 T A 2: 153,259,350 probably benign Het
Prl2b1 G T 13: 27,385,266 H116Q probably benign Het
Ralgapa2 T C 2: 146,388,502 K1048E probably damaging Het
Scnn1b G A 7: 121,902,820 V234M probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Sh3pxd2a C T 19: 47,268,224 G685D probably benign Het
Six4 C A 12: 73,103,525 G749C probably benign Het
Tnn G A 1: 160,114,583 T1115I probably damaging Het
Tpcn1 T A 5: 120,537,562 Q779L probably null Het
Ugt2a2 A G 5: 87,474,600 Y380H probably damaging Het
Xkr8 T C 4: 132,727,938 T375A probably benign Het
Zdhhc20 T A 14: 57,858,575 K135N probably damaging Het
Zfp354c A G 11: 50,814,691 V519A probably damaging Het
Other mutations in Zfp235
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Zfp235 APN 7 24137080 missense probably damaging 1.00
IGL02326:Zfp235 APN 7 24135302 start codon destroyed probably null 0.98
R0107:Zfp235 UTSW 7 24137116 missense probably damaging 1.00
R0271:Zfp235 UTSW 7 24137131 missense possibly damaging 0.93
R0513:Zfp235 UTSW 7 24142219 missense probably damaging 1.00
R1004:Zfp235 UTSW 7 24140744 missense probably damaging 1.00
R1928:Zfp235 UTSW 7 24141138 nonsense probably null
R1958:Zfp235 UTSW 7 24140346 missense probably damaging 0.98
R2167:Zfp235 UTSW 7 24140962 missense possibly damaging 0.80
R2511:Zfp235 UTSW 7 24142124 missense probably damaging 1.00
R3013:Zfp235 UTSW 7 24140732 missense probably damaging 0.98
R3806:Zfp235 UTSW 7 24140621 missense probably benign 0.01
R4613:Zfp235 UTSW 7 24141676 missense probably damaging 1.00
R4876:Zfp235 UTSW 7 24140959 missense probably benign 0.01
R4977:Zfp235 UTSW 7 24142184 missense possibly damaging 0.94
R5085:Zfp235 UTSW 7 24137121 missense probably damaging 0.96
R5664:Zfp235 UTSW 7 24142151 missense probably damaging 1.00
R6440:Zfp235 UTSW 7 24140615 missense probably damaging 0.96
R7694:Zfp235 UTSW 7 24142100 missense probably benign 0.37
R8031:Zfp235 UTSW 7 24141689 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CCTCTGTAGCTATAGAAAGGGGTG -3'
(R):5'- ACGGGTGTGAACTCTGACATC -3'

Sequencing Primer
(F):5'- GTTGACACCAGCGAGAGTCATC -3'
(R):5'- GGTGTGAACTCTGACATCACCAAG -3'
Posted On2018-07-23