Incidental Mutation 'R6650:Scnn1b'
ID527743
Institutional Source Beutler Lab
Gene Symbol Scnn1b
Ensembl Gene ENSMUSG00000030873
Gene Namesodium channel, nonvoltage-gated 1 beta
SynonymsENaC beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6650 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location121865038-121918514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121902820 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 234 (V234M)
Ref Sequence ENSEMBL: ENSMUSP00000033161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033161] [ENSMUST00000205438] [ENSMUST00000205520] [ENSMUST00000206079]
Predicted Effect probably damaging
Transcript: ENSMUST00000033161
AA Change: V234M

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033161
Gene: ENSMUSG00000030873
AA Change: V234M

DomainStartEndE-ValueType
Pfam:ASC 29 541 2.4e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205438
Predicted Effect possibly damaging
Transcript: ENSMUST00000205520
AA Change: V234M

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000206079
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nonvoltage-gated, amiloride-sensitive, sodium channels control fluid and electrolyte transport across epithelia in many organs. These channels are heteromeric complexes consisting of 3 subunits: alpha, beta, and gamma. This gene encodes the beta subunit, and mutations in this gene have been associated with pseudohypoaldosteronism type 1 (PHA1), and Liddle syndrome. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous mutation of this gene results in death shortly after birth, decreased serum sodium levels but higher urine sodium levels and increased serum potassium and chloride levels but lower potassium urine levels. Another homozygous mutation exhibits no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,681,922 N97S probably benign Het
Aph1a T C 3: 95,896,286 V220A probably benign Het
Bin2 T A 15: 100,669,420 Q25L probably damaging Het
Ccdc102a T C 8: 94,913,264 E134G probably benign Het
Cdh6 A G 15: 13,051,401 V382A probably benign Het
Cep135 T A 5: 76,633,701 V845E possibly damaging Het
Cngb3 T C 4: 19,364,168 L124P probably damaging Het
Cped1 A G 6: 22,233,976 N725S probably damaging Het
Dcn C A 10: 97,507,743 N188K probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Ercc3 C T 18: 32,261,336 R590C probably damaging Het
Fchsd1 A T 18: 37,966,502 L213* probably null Het
Fmod A G 1: 134,041,007 S262G probably benign Het
Gm14548 T A 7: 3,895,633 Q272L probably benign Het
Gm15448 T A 7: 3,816,899 H555L possibly damaging Het
Gm45861 T C 8: 27,505,015 S530P unknown Het
Ifih1 T C 2: 62,606,447 D544G possibly damaging Het
Itpr1 A G 6: 108,394,073 probably null Het
Larp1 CA CAA 11: 58,058,596 probably null Het
Lbp T A 2: 158,309,667 S102R probably benign Het
Lepr C A 4: 101,815,201 Q1141K probably damaging Het
Mcm8 C A 2: 132,821,407 N148K probably benign Het
Mcpt4 T G 14: 56,060,633 T154P possibly damaging Het
Mrpl22 A G 11: 58,175,308 Y76C probably damaging Het
Msln T C 17: 25,750,170 I414V probably benign Het
Ncor1 G A 11: 62,334,541 T1798I probably damaging Het
Nlrp4c T A 7: 6,065,949 F283Y probably damaging Het
Os9 C T 10: 127,100,084 probably null Het
Pja2 T C 17: 64,292,941 E516G probably damaging Het
Pofut1 T A 2: 153,259,350 probably benign Het
Prl2b1 G T 13: 27,385,266 H116Q probably benign Het
Ralgapa2 T C 2: 146,388,502 K1048E probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Sh3pxd2a C T 19: 47,268,224 G685D probably benign Het
Six4 C A 12: 73,103,525 G749C probably benign Het
Tnn G A 1: 160,114,583 T1115I probably damaging Het
Tpcn1 T A 5: 120,537,562 Q779L probably null Het
Ugt2a2 A G 5: 87,474,600 Y380H probably damaging Het
Xkr8 T C 4: 132,727,938 T375A probably benign Het
Zdhhc20 T A 14: 57,858,575 K135N probably damaging Het
Zfp235 T A 7: 24,137,038 probably null Het
Zfp354c A G 11: 50,814,691 V519A probably damaging Het
Other mutations in Scnn1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Scnn1b APN 7 121918036 missense probably damaging 1.00
IGL01108:Scnn1b APN 7 121914332 splice site probably null
IGL02191:Scnn1b APN 7 121917513 missense probably damaging 1.00
IGL02197:Scnn1b APN 7 121902890 missense probably null 0.89
IGL02355:Scnn1b APN 7 121917547 missense probably damaging 1.00
IGL02362:Scnn1b APN 7 121917547 missense probably damaging 1.00
IGL02554:Scnn1b APN 7 121917523 missense probably damaging 1.00
IGL02834:Scnn1b APN 7 121912062 missense probably damaging 1.00
R0266:Scnn1b UTSW 7 121912475 missense probably damaging 1.00
R0494:Scnn1b UTSW 7 121899458 missense probably damaging 1.00
R0849:Scnn1b UTSW 7 121912475 missense probably damaging 1.00
R0872:Scnn1b UTSW 7 121914330 critical splice donor site probably null
R0899:Scnn1b UTSW 7 121917715 missense probably damaging 1.00
R1386:Scnn1b UTSW 7 121902488 missense possibly damaging 0.60
R1406:Scnn1b UTSW 7 121902544 critical splice donor site probably null
R1406:Scnn1b UTSW 7 121902544 critical splice donor site probably null
R1662:Scnn1b UTSW 7 121902328 missense probably benign 0.00
R1782:Scnn1b UTSW 7 121917961 missense probably benign
R1829:Scnn1b UTSW 7 121902845 missense probably benign 0.00
R1861:Scnn1b UTSW 7 121914261 missense probably damaging 1.00
R1928:Scnn1b UTSW 7 121910447 missense probably damaging 1.00
R4016:Scnn1b UTSW 7 121914332 splice site probably null
R4192:Scnn1b UTSW 7 121902739 missense possibly damaging 0.63
R4504:Scnn1b UTSW 7 121912475 missense probably damaging 1.00
R4745:Scnn1b UTSW 7 121902286 missense probably benign 0.03
R4888:Scnn1b UTSW 7 121902887 missense probably benign 0.06
R4941:Scnn1b UTSW 7 121912008 missense probably damaging 1.00
R5121:Scnn1b UTSW 7 121902887 missense probably benign 0.06
R6379:Scnn1b UTSW 7 121915328 missense probably benign 0.10
R6516:Scnn1b UTSW 7 121912112 missense probably damaging 1.00
R6730:Scnn1b UTSW 7 121902877 missense probably damaging 1.00
R7151:Scnn1b UTSW 7 121917886 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGATTCCTTCCTGAGAAGCG -3'
(R):5'- CAGGCTGCAACAAGACACTGAG -3'

Sequencing Primer
(F):5'- AGAAGCGCTGCCACTCCTTC -3'
(R):5'- GTGCTGTAGACAGCTACT -3'
Posted On2018-07-23