Mutagenetix > Incidental Mutation

Incidental Mutation 'R6650:Ncor1'

527751

Institutional Source

Beutler Lab

Gene Symbol

Ncor1

Ensembl Gene

ENSMUSG00000018501

Gene Name

nuclear receptor co-repressor 1

Synonyms

Rxrip13, 5730405M06Rik, A230020K14Rik, N-CoR

MMRRC Submission

044771-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6650 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

62207132-62348200 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 62225367 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1798 (T1798I)

Ref Sequence

ENSEMBL: ENSMUSP00000098627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018645] [ENSMUST00000037575] [ENSMUST00000101066] [ENSMUST00000101067] [ENSMUST00000155712]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000018645
AA Change: T1798I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000018645
Gene: ENSMUSG00000018501
AA Change: T1798I

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
Pfam:GPS2_interact	150	239	1.4e-37	PFAM
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	507	544	N/A	INTRINSIC
low complexity region	593	617	N/A	INTRINSIC
SANT	624	672	3.29e-14	SMART
low complexity region	710	731	N/A	INTRINSIC
low complexity region	771	788	N/A	INTRINSIC
low complexity region	888	899	N/A	INTRINSIC
low complexity region	987	995	N/A	INTRINSIC
low complexity region	1002	1013	N/A	INTRINSIC
low complexity region	1036	1049	N/A	INTRINSIC
internal_repeat_2	1061	1298	1.62e-6	PROSPERO
internal_repeat_2	1299	1515	1.62e-6	PROSPERO
low complexity region	1516	1527	N/A	INTRINSIC
coiled coil region	1712	1749	N/A	INTRINSIC
low complexity region	1834	1848	N/A	INTRINSIC
low complexity region	1969	1980	N/A	INTRINSIC
low complexity region	2036	2055	N/A	INTRINSIC
PDB:3N00\|B	2064	2084	4e-7	PDB
low complexity region	2086	2101	N/A	INTRINSIC
low complexity region	2157	2168	N/A	INTRINSIC
PDB:2OVM\|B	2267	2290	2e-8	PDB
low complexity region	2311	2324	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000037575
AA Change: T744I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000038900
Gene: ENSMUSG00000018501
AA Change: T744I

Domain	Start	End	E-Value	Type
low complexity region	28	41	N/A	INTRINSIC
low complexity region	461	472	N/A	INTRINSIC
coiled coil region	658	695	N/A	INTRINSIC
low complexity region	780	794	N/A	INTRINSIC
low complexity region	915	926	N/A	INTRINSIC
low complexity region	982	1001	N/A	INTRINSIC
PDB:3N00\|B	1010	1030	2e-7	PDB
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1102	1113	N/A	INTRINSIC
PDB:2OVM\|B	1212	1235	2e-8	PDB
low complexity region	1256	1269	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000101066
AA Change: T1798I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000098627
Gene: ENSMUSG00000018501
AA Change: T1798I

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
coiled coil region	176	217	N/A	INTRINSIC
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	507	544	N/A	INTRINSIC
low complexity region	593	617	N/A	INTRINSIC
SANT	624	672	3.29e-14	SMART
low complexity region	710	731	N/A	INTRINSIC
low complexity region	771	788	N/A	INTRINSIC
low complexity region	888	899	N/A	INTRINSIC
low complexity region	987	995	N/A	INTRINSIC
low complexity region	1002	1013	N/A	INTRINSIC
low complexity region	1036	1049	N/A	INTRINSIC
internal_repeat_2	1061	1298	1.62e-6	PROSPERO
internal_repeat_2	1299	1515	1.62e-6	PROSPERO
low complexity region	1516	1527	N/A	INTRINSIC
coiled coil region	1712	1749	N/A	INTRINSIC
low complexity region	1834	1848	N/A	INTRINSIC
low complexity region	1969	1980	N/A	INTRINSIC
low complexity region	2036	2055	N/A	INTRINSIC
PDB:3N00\|B	2064	2084	4e-7	PDB
low complexity region	2086	2101	N/A	INTRINSIC
low complexity region	2157	2168	N/A	INTRINSIC
PDB:2OVM\|B	2267	2290	2e-8	PDB
low complexity region	2311	2324	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000101067
AA Change: T1731I

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000098628
Gene: ENSMUSG00000018501
AA Change: T1731I

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
coiled coil region	176	217	N/A	INTRINSIC
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	507	544	N/A	INTRINSIC
low complexity region	593	617	N/A	INTRINSIC
SANT	624	672	3.29e-14	SMART
low complexity region	716	734	N/A	INTRINSIC
low complexity region	838	849	N/A	INTRINSIC
low complexity region	937	945	N/A	INTRINSIC
low complexity region	952	963	N/A	INTRINSIC
low complexity region	986	999	N/A	INTRINSIC
low complexity region	1448	1459	N/A	INTRINSIC
coiled coil region	1645	1682	N/A	INTRINSIC
low complexity region	1767	1781	N/A	INTRINSIC
low complexity region	1902	1913	N/A	INTRINSIC
low complexity region	1969	1988	N/A	INTRINSIC
PDB:3N00\|B	1997	2017	4e-7	PDB
low complexity region	2019	2034	N/A	INTRINSIC
low complexity region	2089	2100	N/A	INTRINSIC
PDB:2OVM\|B	2199	2222	2e-8	PDB
low complexity region	2243	2256	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000121709

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131911

Predicted Effect

probably damaging
Transcript: ENSMUST00000155712
AA Change: T1068I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000122654
Gene: ENSMUSG00000018501
AA Change: T1068I

Domain	Start	End	E-Value	Type
low complexity region	26	47	N/A	INTRINSIC
low complexity region	87	104	N/A	INTRINSIC
low complexity region	204	215	N/A	INTRINSIC
low complexity region	303	311	N/A	INTRINSIC
low complexity region	318	329	N/A	INTRINSIC
low complexity region	352	365	N/A	INTRINSIC
low complexity region	785	796	N/A	INTRINSIC
coiled coil region	982	1019	N/A	INTRINSIC
low complexity region	1104	1118	N/A	INTRINSIC
low complexity region	1239	1250	N/A	INTRINSIC
low complexity region	1306	1325	N/A	INTRINSIC
PDB:3N00\|B	1334	1354	3e-7	PDB
low complexity region	1356	1371	N/A	INTRINSIC
low complexity region	1427	1438	N/A	INTRINSIC
PDB:2OVM\|B	1537	1560	2e-8	PDB
low complexity region	1581	1594	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000156740
AA Change: T733I

SMART Domains

Protein: ENSMUSP00000125458
Gene: ENSMUSG00000018501
AA Change: T733I

Domain	Start	End	E-Value	Type
low complexity region	18	31	N/A	INTRINSIC
low complexity region	451	462	N/A	INTRINSIC
coiled coil region	647	684	N/A	INTRINSIC
low complexity region	770	784	N/A	INTRINSIC
low complexity region	905	916	N/A	INTRINSIC
low complexity region	972	991	N/A	INTRINSIC
PDB:3N00\|B	1000	1020	2e-7	PDB
low complexity region	1022	1037	N/A	INTRINSIC
low complexity region	1092	1103	N/A	INTRINSIC
PDB:2OVM\|B	1202	1225	2e-8	PDB
low complexity region	1246	1259	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161281

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161767

Meta Mutation Damage Score

0.1120

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that mediates ligand-independent transcription repression of thyroid-hormone and retinoic-acid receptors by promoting chromatin condensation and preventing access of the transcription machinery. It is part of a complex which also includes histone deacetylases and transcriptional regulators similar to the yeast protein Sin3p. This gene is located between the Charcot-Marie-Tooth and Smith-Magenis syndrome critical regions on chromosome 17. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 17 and 20.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene exhibit embryonic lethality with erythrocytic, thymocytic and central nervous system development abnormalities. Mice homozygous for a hypomorphic allele exhibit increased thyroid hormone sensitivity under hypothyroid conditions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl3	A	G	1: 78,659,639 (GRCm39)	N97S	probably benign	Het
Aph1a	T	C	3: 95,803,598 (GRCm39)	V220A	probably benign	Het
Bin2	T	A	15: 100,567,301 (GRCm39)	Q25L	probably damaging	Het
Ccdc102a	T	C	8: 95,639,892 (GRCm39)	E134G	probably benign	Het
Cdh6	A	G	15: 13,051,487 (GRCm39)	V382A	probably benign	Het
Cep135	T	A	5: 76,781,548 (GRCm39)	V845E	possibly damaging	Het
Cngb3	T	C	4: 19,364,168 (GRCm39)	L124P	probably damaging	Het
Cped1	A	G	6: 22,233,975 (GRCm39)	N725S	probably damaging	Het
Dcn	C	A	10: 97,343,605 (GRCm39)	N188K	probably benign	Het
Dnah7c	C	A	1: 46,688,500 (GRCm39)	T1890K	probably benign	Het
Dnah7c	A	G	1: 46,688,511 (GRCm39)	S1894G	probably benign	Het
Eef2	CCC	CCCC	10: 81,014,602 (GRCm39)		probably null	Het
Ercc3	C	T	18: 32,394,389 (GRCm39)	R590C	probably damaging	Het
Fchsd1	A	T	18: 38,099,555 (GRCm39)	L213*	probably null	Het
Fmod	A	G	1: 133,968,745 (GRCm39)	S262G	probably benign	Het
Gm45861	T	C	8: 27,995,043 (GRCm39)	S530P	unknown	Het
Ifih1	T	C	2: 62,436,791 (GRCm39)	D544G	possibly damaging	Het
Itpr1	A	G	6: 108,371,034 (GRCm39)		probably null	Het
Larp1	CA	CAA	11: 57,949,422 (GRCm39)		probably null	Het
Lbp	T	A	2: 158,151,587 (GRCm39)	S102R	probably benign	Het
Lepr	C	A	4: 101,672,398 (GRCm39)	Q1141K	probably damaging	Het
Mcm8	C	A	2: 132,663,327 (GRCm39)	N148K	probably benign	Het
Mcpt4	T	G	14: 56,298,090 (GRCm39)	T154P	possibly damaging	Het
Mrpl22	A	G	11: 58,066,134 (GRCm39)	Y76C	probably damaging	Het
Msln	T	C	17: 25,969,144 (GRCm39)	I414V	probably benign	Het
Nlrp4c	T	A	7: 6,068,948 (GRCm39)	F283Y	probably damaging	Het
Os9	C	T	10: 126,935,953 (GRCm39)		probably null	Het
Pira12	T	A	7: 3,898,632 (GRCm39)	Q272L	probably benign	Het
Pira13	T	A	7: 3,819,898 (GRCm39)	H555L	possibly damaging	Het
Pja2	T	C	17: 64,599,936 (GRCm39)	E516G	probably damaging	Het
Pofut1	T	A	2: 153,101,270 (GRCm39)		probably benign	Het
Prl2b1	G	T	13: 27,569,249 (GRCm39)	H116Q	probably benign	Het
Ralgapa2	T	C	2: 146,230,422 (GRCm39)	K1048E	probably damaging	Het
Scnn1b	G	A	7: 121,502,043 (GRCm39)	V234M	probably damaging	Het
Sfxn3	G	A	19: 45,038,354 (GRCm39)		probably null	Het
Sh3pxd2a	C	T	19: 47,256,663 (GRCm39)	G685D	probably benign	Het
Six4	C	A	12: 73,150,299 (GRCm39)	G749C	probably benign	Het
Tnn	G	A	1: 159,942,153 (GRCm39)	T1115I	probably damaging	Het
Tpcn1	T	A	5: 120,675,627 (GRCm39)	Q779L	probably null	Het
Ugt2a2	A	G	5: 87,622,459 (GRCm39)	Y380H	probably damaging	Het
Xkr8	T	C	4: 132,455,249 (GRCm39)	T375A	probably benign	Het
Zdhhc20	T	A	14: 58,096,032 (GRCm39)	K135N	probably damaging	Het
Zfp235	T	A	7: 23,836,463 (GRCm39)		probably null	Het
Zfp354c	A	G	11: 50,705,518 (GRCm39)	V519A	probably damaging	Het

Other mutations in Ncor1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01067:Ncor1	APN	11	62,283,354 (GRCm39)	missense	probably damaging	1.00
IGL01343:Ncor1	APN	11	62,216,312 (GRCm39)	critical splice donor site	probably null
IGL01392:Ncor1	APN	11	62,231,420 (GRCm39)	missense	probably damaging	0.99
IGL01402:Ncor1	APN	11	62,231,300 (GRCm39)	missense	probably damaging	1.00
IGL01714:Ncor1	APN	11	62,225,410 (GRCm39)	missense	possibly damaging	0.58
IGL01772:Ncor1	APN	11	62,240,173 (GRCm39)	intron	probably benign
IGL01889:Ncor1	APN	11	62,225,427 (GRCm39)	missense	possibly damaging	0.69
IGL02058:Ncor1	APN	11	62,235,463 (GRCm39)	missense	probably damaging	1.00
IGL02065:Ncor1	APN	11	62,310,435 (GRCm39)	missense	possibly damaging	0.95
IGL02073:Ncor1	APN	11	62,249,743 (GRCm39)	missense	probably damaging	0.99
IGL02176:Ncor1	APN	11	62,220,485 (GRCm39)	unclassified	probably benign
IGL02288:Ncor1	APN	11	62,240,229 (GRCm39)	missense	probably benign	0.01
IGL02348:Ncor1	APN	11	62,224,485 (GRCm39)	splice site	probably benign
IGL02608:Ncor1	APN	11	62,264,040 (GRCm39)	missense	probably benign	0.07
laggard	UTSW	11	62,260,130 (GRCm39)	missense	probably damaging	1.00
Shortstep	UTSW	11	62,225,367 (GRCm39)	missense	probably damaging	1.00
LCD18:Ncor1	UTSW	11	62,419,782 (GRCm38)	critical splice acceptor site	probably benign
PIT4382001:Ncor1	UTSW	11	62,235,489 (GRCm39)	missense	probably damaging	0.96
PIT4576001:Ncor1	UTSW	11	62,224,543 (GRCm39)	missense	probably damaging	0.99
R0026:Ncor1	UTSW	11	62,329,255 (GRCm39)	missense	probably damaging	1.00
R0038:Ncor1	UTSW	11	62,283,377 (GRCm39)	missense	probably damaging	0.99
R0038:Ncor1	UTSW	11	62,283,377 (GRCm39)	missense	probably damaging	0.99
R0103:Ncor1	UTSW	11	62,233,871 (GRCm39)	missense	possibly damaging	0.85
R0103:Ncor1	UTSW	11	62,233,871 (GRCm39)	missense	possibly damaging	0.85
R0144:Ncor1	UTSW	11	62,283,421 (GRCm39)	missense	probably damaging	1.00
R0427:Ncor1	UTSW	11	62,301,746 (GRCm39)	missense	probably damaging	1.00
R0501:Ncor1	UTSW	11	62,264,148 (GRCm39)	missense	possibly damaging	0.73
R0544:Ncor1	UTSW	11	62,224,603 (GRCm39)	missense	probably damaging	1.00
R0544:Ncor1	UTSW	11	62,224,602 (GRCm39)	missense	probably damaging	1.00
R0563:Ncor1	UTSW	11	62,234,056 (GRCm39)	missense	probably damaging	0.97
R1074:Ncor1	UTSW	11	62,283,377 (GRCm39)	missense	probably damaging	0.99
R1266:Ncor1	UTSW	11	62,224,866 (GRCm39)	missense	probably damaging	0.98
R1444:Ncor1	UTSW	11	62,294,632 (GRCm39)	missense	probably damaging	1.00
R1452:Ncor1	UTSW	11	62,225,457 (GRCm39)	missense	probably damaging	1.00
R1534:Ncor1	UTSW	11	62,269,330 (GRCm39)	missense	possibly damaging	0.92
R1710:Ncor1	UTSW	11	62,313,831 (GRCm39)	missense	probably damaging	1.00
R1762:Ncor1	UTSW	11	62,275,610 (GRCm39)	missense	possibly damaging	0.82
R1771:Ncor1	UTSW	11	62,217,938 (GRCm39)	missense	probably damaging	1.00
R1864:Ncor1	UTSW	11	62,272,245 (GRCm39)	missense	probably damaging	1.00
R1902:Ncor1	UTSW	11	62,228,984 (GRCm39)	missense	probably damaging	1.00
R1906:Ncor1	UTSW	11	62,240,211 (GRCm39)	missense	possibly damaging	0.81
R2009:Ncor1	UTSW	11	62,216,427 (GRCm39)	missense	probably benign	0.43
R3708:Ncor1	UTSW	11	62,235,513 (GRCm39)	missense	probably damaging	1.00
R3825:Ncor1	UTSW	11	62,264,183 (GRCm39)	missense	probably benign	0.00
R3923:Ncor1	UTSW	11	62,216,442 (GRCm39)	missense	probably damaging	1.00
R3966:Ncor1	UTSW	11	62,235,583 (GRCm39)	missense	probably damaging	1.00
R4049:Ncor1	UTSW	11	62,220,494 (GRCm39)	splice site	probably null
R4350:Ncor1	UTSW	11	62,301,644 (GRCm39)	critical splice donor site	probably null
R4351:Ncor1	UTSW	11	62,301,644 (GRCm39)	critical splice donor site	probably null
R4359:Ncor1	UTSW	11	62,249,736 (GRCm39)	missense	probably damaging	1.00
R4712:Ncor1	UTSW	11	62,235,660 (GRCm39)	missense	probably damaging	1.00
R4723:Ncor1	UTSW	11	62,269,438 (GRCm39)	missense	probably benign	0.26
R4863:Ncor1	UTSW	11	62,283,464 (GRCm39)	missense	possibly damaging	0.92
R4875:Ncor1	UTSW	11	62,324,437 (GRCm39)	small deletion	probably benign
R4956:Ncor1	UTSW	11	62,231,431 (GRCm39)	missense	probably damaging	1.00
R4993:Ncor1	UTSW	11	62,234,167 (GRCm39)	missense	probably damaging	1.00
R5079:Ncor1	UTSW	11	62,236,063 (GRCm39)	missense	possibly damaging	0.92
R5144:Ncor1	UTSW	11	62,240,290 (GRCm39)	missense	probably damaging	1.00
R5223:Ncor1	UTSW	11	62,229,826 (GRCm39)	missense	probably damaging	1.00
R5243:Ncor1	UTSW	11	62,229,788 (GRCm39)	missense	probably damaging	1.00
R5271:Ncor1	UTSW	11	62,231,371 (GRCm39)	missense	probably damaging	1.00
R5285:Ncor1	UTSW	11	62,283,475 (GRCm39)	missense	probably damaging	1.00
R5533:Ncor1	UTSW	11	62,233,837 (GRCm39)	missense	probably benign	0.00
R5580:Ncor1	UTSW	11	62,280,604 (GRCm39)	nonsense	probably null
R5593:Ncor1	UTSW	11	62,260,130 (GRCm39)	missense	probably damaging	1.00
R5609:Ncor1	UTSW	11	62,249,679 (GRCm39)	splice site	probably null
R5632:Ncor1	UTSW	11	62,229,060 (GRCm39)	missense	possibly damaging	0.85
R5830:Ncor1	UTSW	11	62,235,589 (GRCm39)	missense	possibly damaging	0.71
R5896:Ncor1	UTSW	11	62,274,016 (GRCm39)	missense	probably damaging	1.00
R5973:Ncor1	UTSW	11	62,240,136 (GRCm39)	splice site	probably null
R6013:Ncor1	UTSW	11	62,211,903 (GRCm39)	missense	probably benign
R6019:Ncor1	UTSW	11	62,263,987 (GRCm39)	missense	probably benign	0.00
R6032:Ncor1	UTSW	11	62,264,147 (GRCm39)	missense	possibly damaging	0.54
R6032:Ncor1	UTSW	11	62,264,147 (GRCm39)	missense	possibly damaging	0.54
R6075:Ncor1	UTSW	11	62,208,675 (GRCm39)	missense	probably damaging	1.00
R6091:Ncor1	UTSW	11	62,310,443 (GRCm39)	missense	probably damaging	0.98
R6248:Ncor1	UTSW	11	62,257,808 (GRCm39)	missense	probably damaging	1.00
R6281:Ncor1	UTSW	11	62,264,371 (GRCm39)	missense	possibly damaging	0.71
R6351:Ncor1	UTSW	11	62,264,124 (GRCm39)	missense	probably benign	0.30
R6469:Ncor1	UTSW	11	62,234,128 (GRCm39)	missense	probably damaging	1.00
R6502:Ncor1	UTSW	11	62,272,240 (GRCm39)	nonsense	probably null
R6614:Ncor1	UTSW	11	62,221,645 (GRCm39)	missense	probably benign	0.01
R6765:Ncor1	UTSW	11	62,264,272 (GRCm39)	missense	probably benign	0.01
R6852:Ncor1	UTSW	11	62,234,071 (GRCm39)	missense	probably damaging	0.97
R6909:Ncor1	UTSW	11	62,220,312 (GRCm39)	missense	probably damaging	1.00
R6965:Ncor1	UTSW	11	62,244,059 (GRCm39)	critical splice donor site	probably null
R7054:Ncor1	UTSW	11	62,275,619 (GRCm39)	missense	probably null
R7248:Ncor1	UTSW	11	62,275,598 (GRCm39)	missense	possibly damaging	0.89
R7352:Ncor1	UTSW	11	62,224,737 (GRCm39)	missense	probably damaging	0.99
R7396:Ncor1	UTSW	11	62,234,044 (GRCm39)	missense	probably damaging	0.99
R7434:Ncor1	UTSW	11	62,274,025 (GRCm39)	missense	probably damaging	0.99
R7552:Ncor1	UTSW	11	62,264,250 (GRCm39)	missense	possibly damaging	0.53
R7565:Ncor1	UTSW	11	62,292,091 (GRCm39)	missense	probably damaging	1.00
R7575:Ncor1	UTSW	11	62,274,082 (GRCm39)	missense	probably benign	0.21
R7622:Ncor1	UTSW	11	62,208,794 (GRCm39)	missense	probably benign	0.00
R7664:Ncor1	UTSW	11	62,289,154 (GRCm39)	missense	probably damaging	1.00
R7814:Ncor1	UTSW	11	62,224,752 (GRCm39)	missense	probably damaging	0.99
R7963:Ncor1	UTSW	11	62,225,359 (GRCm39)	missense	probably benign	0.28
R7990:Ncor1	UTSW	11	62,240,321 (GRCm39)	critical splice acceptor site	probably null
R8302:Ncor1	UTSW	11	62,224,681 (GRCm39)	missense	probably benign	0.00
R8334:Ncor1	UTSW	11	62,274,070 (GRCm39)	missense	probably damaging	0.99
R8512:Ncor1	UTSW	11	62,324,437 (GRCm39)	small deletion	probably benign
R8728:Ncor1	UTSW	11	62,221,685 (GRCm39)	missense	probably benign	0.04
R8777:Ncor1	UTSW	11	62,324,494 (GRCm39)	missense	probably damaging	1.00
R8777:Ncor1	UTSW	11	62,324,492 (GRCm39)	missense	probably benign	0.03
R8777-TAIL:Ncor1	UTSW	11	62,324,494 (GRCm39)	missense	probably damaging	1.00
R8777-TAIL:Ncor1	UTSW	11	62,324,492 (GRCm39)	missense	probably benign	0.03
R8821:Ncor1	UTSW	11	62,260,234 (GRCm39)	missense	probably benign	0.07
R8831:Ncor1	UTSW	11	62,260,234 (GRCm39)	missense	probably benign	0.07
R8988:Ncor1	UTSW	11	62,233,871 (GRCm39)	nonsense	probably null
R9111:Ncor1	UTSW	11	62,280,585 (GRCm39)	missense	possibly damaging	0.95
R9147:Ncor1	UTSW	11	62,224,672 (GRCm39)	missense	probably damaging	1.00
R9391:Ncor1	UTSW	11	62,216,376 (GRCm39)	nonsense	probably null
R9467:Ncor1	UTSW	11	62,324,448 (GRCm39)	small insertion	probably benign
R9467:Ncor1	UTSW	11	62,324,437 (GRCm39)	small insertion	probably benign
R9510:Ncor1	UTSW	11	62,324,442 (GRCm39)	small insertion	probably benign
R9511:Ncor1	UTSW	11	62,324,449 (GRCm39)	small insertion	probably benign
R9560:Ncor1	UTSW	11	62,263,948 (GRCm39)	missense	possibly damaging	0.96
R9687:Ncor1	UTSW	11	62,260,193 (GRCm39)	missense	possibly damaging	0.93
X0065:Ncor1	UTSW	11	62,249,817 (GRCm39)	missense	probably benign	0.23
X0065:Ncor1	UTSW	11	62,245,395 (GRCm39)	critical splice donor site	probably null
Z1176:Ncor1	UTSW	11	62,329,342 (GRCm39)	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTGACTTATGGAAGGGCCCC -3'
(R):5'- TGCTGCCCGTATTTCTGTAG -3'

Sequencing Primer
(F):5'- GCCGAGGCTCAAAATCTTAGTTC -3'
(R):5'- AGCTGTTTCTTTTGGATTATCAGTC -3'

Posted On

2018-07-23