Incidental Mutation 'R6650:Mcpt4'
ID527754
Institutional Source Beutler Lab
Gene Symbol Mcpt4
Ensembl Gene ENSMUSG00000061068
Gene Namemast cell protease 4
SynonymsMMCP-4B, Mcp4, myonase, Mcp-4, MMCP-4, MMCP-4A
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6650 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location56059629-56062313 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 56060633 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 154 (T154P)
Ref Sequence ENSEMBL: ENSMUSP00000038103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043249]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043249
AA Change: T154P

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038103
Gene: ENSMUSG00000061068
AA Change: T154P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Tryp_SPc 20 239 6.1e-88 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this locus affects thrombin regulation and fibronectin turnover. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,681,922 N97S probably benign Het
Aph1a T C 3: 95,896,286 V220A probably benign Het
Bin2 T A 15: 100,669,420 Q25L probably damaging Het
Ccdc102a T C 8: 94,913,264 E134G probably benign Het
Cdh6 A G 15: 13,051,401 V382A probably benign Het
Cep135 T A 5: 76,633,701 V845E possibly damaging Het
Cngb3 T C 4: 19,364,168 L124P probably damaging Het
Cped1 A G 6: 22,233,976 N725S probably damaging Het
Dcn C A 10: 97,507,743 N188K probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Ercc3 C T 18: 32,261,336 R590C probably damaging Het
Fchsd1 A T 18: 37,966,502 L213* probably null Het
Fmod A G 1: 134,041,007 S262G probably benign Het
Gm14548 T A 7: 3,895,633 Q272L probably benign Het
Gm15448 T A 7: 3,816,899 H555L possibly damaging Het
Gm45861 T C 8: 27,505,015 S530P unknown Het
Ifih1 T C 2: 62,606,447 D544G possibly damaging Het
Itpr1 A G 6: 108,394,073 probably null Het
Larp1 CA CAA 11: 58,058,596 probably null Het
Lbp T A 2: 158,309,667 S102R probably benign Het
Lepr C A 4: 101,815,201 Q1141K probably damaging Het
Mcm8 C A 2: 132,821,407 N148K probably benign Het
Mrpl22 A G 11: 58,175,308 Y76C probably damaging Het
Msln T C 17: 25,750,170 I414V probably benign Het
Ncor1 G A 11: 62,334,541 T1798I probably damaging Het
Nlrp4c T A 7: 6,065,949 F283Y probably damaging Het
Os9 C T 10: 127,100,084 probably null Het
Pja2 T C 17: 64,292,941 E516G probably damaging Het
Pofut1 T A 2: 153,259,350 probably benign Het
Prl2b1 G T 13: 27,385,266 H116Q probably benign Het
Ralgapa2 T C 2: 146,388,502 K1048E probably damaging Het
Scnn1b G A 7: 121,902,820 V234M probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Sh3pxd2a C T 19: 47,268,224 G685D probably benign Het
Six4 C A 12: 73,103,525 G749C probably benign Het
Tnn G A 1: 160,114,583 T1115I probably damaging Het
Tpcn1 T A 5: 120,537,562 Q779L probably null Het
Ugt2a2 A G 5: 87,474,600 Y380H probably damaging Het
Xkr8 T C 4: 132,727,938 T375A probably benign Het
Zdhhc20 T A 14: 57,858,575 K135N probably damaging Het
Zfp235 T A 7: 24,137,038 probably null Het
Zfp354c A G 11: 50,814,691 V519A probably damaging Het
Other mutations in Mcpt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Mcpt4 APN 14 56061030 missense probably benign
IGL02733:Mcpt4 APN 14 56060667 missense probably benign 0.03
R0622:Mcpt4 UTSW 14 56060662 missense probably benign 0.06
R1699:Mcpt4 UTSW 14 56059959 makesense probably null
R4298:Mcpt4 UTSW 14 56060987 missense possibly damaging 0.70
R4413:Mcpt4 UTSW 14 56060536 missense probably damaging 0.98
R5191:Mcpt4 UTSW 14 56061009 missense probably benign 0.00
R5378:Mcpt4 UTSW 14 56062293 utr 5 prime probably null
R7062:Mcpt4 UTSW 14 56060668 missense probably benign 0.09
R7730:Mcpt4 UTSW 14 56059971 missense probably benign
R7809:Mcpt4 UTSW 14 56060684 missense possibly damaging 0.77
X0019:Mcpt4 UTSW 14 56062272 start codon destroyed probably null 0.94
Z1088:Mcpt4 UTSW 14 56060510 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTACTGCCATGGAGAGATG -3'
(R):5'- TGGTCCCATGTCCAAGCATTC -3'

Sequencing Primer
(F):5'- TGGAGAGATGCTCAGCACACTTC -3'
(R):5'- CCAAGCATTCTTTTCTGATTTGACAG -3'
Posted On2018-07-23