Incidental Mutation 'R6651:Ggta1'
ID527768
Institutional Source Beutler Lab
Gene Symbol Ggta1
Ensembl Gene ENSMUSG00000035778
Gene Nameglycoprotein galactosyltransferase alpha 1, 3
SynonymsGgta, glycoprotein alpha galactosyl transferase 1, GALT, Gal, Ggta-1, alpha3GalT, alpha Gal
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6651 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location35400179-35463231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 35402294 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 334 (H334N)
Ref Sequence ENSEMBL: ENSMUSP00000132408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044255] [ENSMUST00000079424] [ENSMUST00000102794] [ENSMUST00000113001] [ENSMUST00000113002] [ENSMUST00000164889]
Predicted Effect probably benign
Transcript: ENSMUST00000044255
AA Change: H346N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000049408
Gene: ENSMUSG00000035778
AA Change: H346N

DomainStartEndE-ValueType
transmembrane domain 42 60 N/A INTRINSIC
Pfam:Glyco_transf_6 81 404 1.2e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079424
AA Change: H312N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078393
Gene: ENSMUSG00000035778
AA Change: H312N

DomainStartEndE-ValueType
Pfam:Glyco_transf_6 34 370 5.5e-177 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102794
AA Change: H346N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099858
Gene: ENSMUSG00000035778
AA Change: H346N

DomainStartEndE-ValueType
transmembrane domain 42 60 N/A INTRINSIC
Pfam:Glyco_transf_6 74 404 4.3e-182 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113001
AA Change: H324N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108625
Gene: ENSMUSG00000035778
AA Change: H324N

DomainStartEndE-ValueType
Pfam:Glyco_transf_6 45 382 3.6e-177 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113002
AA Change: H334N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108626
Gene: ENSMUSG00000035778
AA Change: H334N

DomainStartEndE-ValueType
transmembrane domain 42 60 N/A INTRINSIC
Pfam:Glyco_transf_6 62 392 3.6e-182 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164889
AA Change: H334N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132408
Gene: ENSMUSG00000035778
AA Change: H334N

DomainStartEndE-ValueType
transmembrane domain 42 60 N/A INTRINSIC
Pfam:Glyco_transf_6 62 392 3.6e-182 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: This gene encodes a member of the galactosyltransferase family of intracellular, membrane-bound enzymes that are involved in the biosynthesis of glycoproteins and glycolipids. The encoded protein catalyzes the transfer of galactose from UDP-galactose to N-acetyllactosamine in an alpha(1,3) linkage to form galactose alpha(1,3)-galactose. Mice lacking the encoded protein develop cortical cataracts. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for disruption of this gene display defects in humoral immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A C 7: 43,498,072 S198A possibly damaging Het
Adamts15 A T 9: 30,922,152 I29N probably damaging Het
Ankrd61 A T 5: 143,893,620 I33N probably damaging Het
Arl6ip1 C T 7: 118,129,485 R7H probably benign Het
Atp8a2 A T 14: 59,774,021 D946E probably benign Het
Cc2d2b A T 19: 40,778,129 Q114L probably damaging Het
Ccdc163 T A 4: 116,709,064 S16R possibly damaging Het
Chil6 C T 3: 106,404,260 C68Y probably damaging Het
Cngb3 G T 4: 19,375,231 R287L probably benign Het
Crem C T 18: 3,325,428 R16H probably benign Het
Cyp4f16 C T 17: 32,544,144 R188C probably benign Het
Dap A G 15: 31,273,207 D46G probably damaging Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Enam T C 5: 88,502,917 Y687H probably damaging Het
Fzd4 A T 7: 89,404,802 D39V possibly damaging Het
Golga3 C T 5: 110,218,130 R1254* probably null Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Helz2 C T 2: 181,239,557 W377* probably null Het
Hfm1 T C 5: 106,847,687 D1286G probably benign Het
Hhatl T C 9: 121,784,702 R425G probably damaging Het
Hivep3 G A 4: 120,122,949 R1728H probably damaging Het
Hyal1 A G 9: 107,579,371 Y419C probably damaging Het
Ighv8-12 A T 12: 115,648,024 D84E possibly damaging Het
Itln1 A G 1: 171,518,372 F271L possibly damaging Het
Klra7 C A 6: 130,229,945 L64F probably benign Het
Kmt2a A T 9: 44,828,811 C1878* probably null Het
Mia2 C A 12: 59,154,362 Q825K possibly damaging Het
Mmp12 C A 9: 7,355,345 P294Q possibly damaging Het
Nedd4 A G 9: 72,731,271 N480S possibly damaging Het
Olfr1255 A T 2: 89,816,896 E190V probably benign Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Pax6 T A 2: 105,685,830 M151K probably benign Het
Pgm1 A G 5: 64,112,094 Y508C probably benign Het
Ptpn20 T C 14: 33,632,940 F324S probably damaging Het
Recql A G 6: 142,364,434 probably null Het
Rerg A G 6: 137,056,386 V97A probably damaging Het
Rffl C A 11: 82,812,779 C106F probably damaging Het
Scaper T G 9: 55,858,504 N499T probably benign Het
Sfxn3 G A 19: 45,049,915 probably null Het
Slc36a4 A G 9: 15,723,578 S139G probably benign Het
Slco2b1 T A 7: 99,667,169 M385L probably benign Het
Smg8 T C 11: 87,086,546 T70A probably benign Het
Spats2l A T 1: 57,946,177 K463M probably damaging Het
Thbs4 T C 13: 92,756,536 I715V probably benign Het
Tmem234 T A 4: 129,607,471 M113K possibly damaging Het
Vmn2r10 T C 5: 108,995,622 I821V probably null Het
Vmn2r116 A T 17: 23,388,831 K458* probably null Het
Vmn2r76 T A 7: 86,228,851 N446I possibly damaging Het
Vmn2r95 T A 17: 18,440,360 Y345N probably damaging Het
Other mutations in Ggta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Ggta1 APN 2 35402450 nonsense probably null
IGL01903:Ggta1 APN 2 35402557 missense possibly damaging 0.74
IGL02796:Ggta1 APN 2 35413317 splice site probably benign
IGL02799:Ggta1 UTSW 2 35422199 missense probably damaging 0.98
R0383:Ggta1 UTSW 2 35402404 missense probably damaging 1.00
R1430:Ggta1 UTSW 2 35408017 missense possibly damaging 0.81
R1667:Ggta1 UTSW 2 35414283 missense possibly damaging 0.83
R1672:Ggta1 UTSW 2 35402133 nonsense probably null
R2246:Ggta1 UTSW 2 35402109 makesense probably null
R3149:Ggta1 UTSW 2 35402623 missense probably damaging 1.00
R3683:Ggta1 UTSW 2 35407988 missense probably benign 0.39
R3684:Ggta1 UTSW 2 35407988 missense probably benign 0.39
R3685:Ggta1 UTSW 2 35407988 missense probably benign 0.39
R4812:Ggta1 UTSW 2 35402723 missense probably benign 0.01
R4856:Ggta1 UTSW 2 35402791 missense possibly damaging 0.59
R5079:Ggta1 UTSW 2 35422237 missense possibly damaging 0.94
R5756:Ggta1 UTSW 2 35402383 missense probably damaging 1.00
R6279:Ggta1 UTSW 2 35407994 missense probably damaging 1.00
R6967:Ggta1 UTSW 2 35402722 missense possibly damaging 0.91
R7152:Ggta1 UTSW 2 35402699 missense probably benign 0.00
R7529:Ggta1 UTSW 2 35414244 missense probably damaging 1.00
R7534:Ggta1 UTSW 2 35402428 missense probably damaging 1.00
R7557:Ggta1 UTSW 2 35402536 missense probably damaging 0.98
X0010:Ggta1 UTSW 2 35402719 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCAGAGTAATAGTGTCAAGTTTCC -3'
(R):5'- AACTTCGGGGTGGAAACTCTG -3'

Sequencing Primer
(F):5'- TCCATCACAATTTGAAGTCAGAC -3'
(R):5'- AAACTCTGGGCCAGCTGGTAG -3'
Posted On2018-07-23