Incidental Mutation 'R6651:Ptpn20'
ID527805
Institutional Source Beutler Lab
Gene Symbol Ptpn20
Ensembl Gene ENSMUSG00000021940
Gene Nameprotein tyrosine phosphatase, non-receptor type 20
Synonymstyp
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6651 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location33589207-33640754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33632940 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 324 (F324S)
Ref Sequence ENSEMBL: ENSMUSP00000022508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022508] [ENSMUST00000226512] [ENSMUST00000227887]
Predicted Effect probably damaging
Transcript: ENSMUST00000022508
AA Change: F324S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022508
Gene: ENSMUSG00000021940
AA Change: F324S

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PTPc 164 420 1.12e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226512
Predicted Effect probably benign
Transcript: ENSMUST00000227887
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of classical tyrosine-specific protein tyrosine phosphatases. Many protein tyrosine phosphatases have been shown to regulate fundamental cellular processes. The encoded protein appears to be targeted to sites of actin polymerization. A pseudogene of this gene has been defined on chromosome 10. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A C 7: 43,498,072 S198A possibly damaging Het
Adamts15 A T 9: 30,922,152 I29N probably damaging Het
Ankrd61 A T 5: 143,893,620 I33N probably damaging Het
Arl6ip1 C T 7: 118,129,485 R7H probably benign Het
Atp8a2 A T 14: 59,774,021 D946E probably benign Het
Cc2d2b A T 19: 40,778,129 Q114L probably damaging Het
Ccdc163 T A 4: 116,709,064 S16R possibly damaging Het
Chil6 C T 3: 106,404,260 C68Y probably damaging Het
Cngb3 G T 4: 19,375,231 R287L probably benign Het
Crem C T 18: 3,325,428 R16H probably benign Het
Cyp4f16 C T 17: 32,544,144 R188C probably benign Het
Dap A G 15: 31,273,207 D46G probably damaging Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Enam T C 5: 88,502,917 Y687H probably damaging Het
Fzd4 A T 7: 89,404,802 D39V possibly damaging Het
Ggta1 G T 2: 35,402,294 H334N probably benign Het
Golga3 C T 5: 110,218,130 R1254* probably null Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Helz2 C T 2: 181,239,557 W377* probably null Het
Hfm1 T C 5: 106,847,687 D1286G probably benign Het
Hhatl T C 9: 121,784,702 R425G probably damaging Het
Hivep3 G A 4: 120,122,949 R1728H probably damaging Het
Hyal1 A G 9: 107,579,371 Y419C probably damaging Het
Ighv8-12 A T 12: 115,648,024 D84E possibly damaging Het
Itln1 A G 1: 171,518,372 F271L possibly damaging Het
Klra7 C A 6: 130,229,945 L64F probably benign Het
Kmt2a A T 9: 44,828,811 C1878* probably null Het
Mia2 C A 12: 59,154,362 Q825K possibly damaging Het
Mmp12 C A 9: 7,355,345 P294Q possibly damaging Het
Nedd4 A G 9: 72,731,271 N480S possibly damaging Het
Olfr1255 A T 2: 89,816,896 E190V probably benign Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Pax6 T A 2: 105,685,830 M151K probably benign Het
Pgm1 A G 5: 64,112,094 Y508C probably benign Het
Recql A G 6: 142,364,434 probably null Het
Rerg A G 6: 137,056,386 V97A probably damaging Het
Rffl C A 11: 82,812,779 C106F probably damaging Het
Scaper T G 9: 55,858,504 N499T probably benign Het
Sfxn3 G A 19: 45,049,915 probably null Het
Slc36a4 A G 9: 15,723,578 S139G probably benign Het
Slco2b1 T A 7: 99,667,169 M385L probably benign Het
Smg8 T C 11: 87,086,546 T70A probably benign Het
Spats2l A T 1: 57,946,177 K463M probably damaging Het
Thbs4 T C 13: 92,756,536 I715V probably benign Het
Tmem234 T A 4: 129,607,471 M113K possibly damaging Het
Vmn2r10 T C 5: 108,995,622 I821V probably null Het
Vmn2r116 A T 17: 23,388,831 K458* probably null Het
Vmn2r76 T A 7: 86,228,851 N446I possibly damaging Het
Vmn2r95 T A 17: 18,440,360 Y345N probably damaging Het
Other mutations in Ptpn20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Ptpn20 APN 14 33622619 missense probably benign 0.22
IGL01510:Ptpn20 APN 14 33638386 splice site probably null
R2057:Ptpn20 UTSW 14 33630985 missense probably damaging 0.98
R2262:Ptpn20 UTSW 14 33612311 missense probably benign
R3106:Ptpn20 UTSW 14 33612296 missense probably benign
R3430:Ptpn20 UTSW 14 33614528 missense possibly damaging 0.61
R4645:Ptpn20 UTSW 14 33631212 missense probably benign
R4928:Ptpn20 UTSW 14 33614489 missense probably benign 0.00
R4962:Ptpn20 UTSW 14 33614459 missense probably benign 0.02
R5087:Ptpn20 UTSW 14 33614441 missense possibly damaging 0.90
R5163:Ptpn20 UTSW 14 33631111 missense probably benign 0.07
R5275:Ptpn20 UTSW 14 33631192 missense probably benign 0.00
R6325:Ptpn20 UTSW 14 33631005 missense possibly damaging 0.52
R6831:Ptpn20 UTSW 14 33632925 missense probably damaging 1.00
R6903:Ptpn20 UTSW 14 33614504 missense probably damaging 0.98
R7034:Ptpn20 UTSW 14 33614435 makesense probably null
R7036:Ptpn20 UTSW 14 33614435 makesense probably null
R7265:Ptpn20 UTSW 14 33614524 missense probably benign 0.05
R7654:Ptpn20 UTSW 14 33638324 missense probably benign 0.18
R7735:Ptpn20 UTSW 14 33630945 missense probably damaging 1.00
R7761:Ptpn20 UTSW 14 33622552 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TGGAGAAAAGCTAATTCTGGCAAC -3'
(R):5'- GAGTAGTTCTTCTCGATGGCAG -3'

Sequencing Primer
(F):5'- GCTAATTCTGGCAACTTTCAGAG -3'
(R):5'- TCTTCTCGATGGCAGAGAAC -3'
Posted On2018-07-23