Incidental Mutation 'R6687:Mettl18'
ID527817
Institutional Source Beutler Lab
Gene Symbol Mettl18
Ensembl Gene ENSMUSG00000041396
Gene Namemethyltransferase like 18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R6687 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location163994889-163997243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 163996800 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 230 (D230G)
Ref Sequence ENSEMBL: ENSMUSP00000107116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045694] [ENSMUST00000045876] [ENSMUST00000097493] [ENSMUST00000111490] [ENSMUST00000160926]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045694
AA Change: D230G

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000048636
Gene: ENSMUSG00000041396
AA Change: D230G

DomainStartEndE-ValueType
Pfam:Methyltransf_16 150 233 7.3e-7 PFAM
Pfam:PrmA 166 240 2.1e-7 PFAM
low complexity region 300 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045876
SMART Domains Protein: ENSMUSP00000043143
Gene: ENSMUSG00000041406

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 2.3e-209 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097493
SMART Domains Protein: ENSMUSP00000095101
Gene: ENSMUSG00000041406

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 1.3e-186 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111490
AA Change: D230G

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107116
Gene: ENSMUSG00000041396
AA Change: D230G

DomainStartEndE-ValueType
Pfam:MTS 147 232 4.5e-6 PFAM
Pfam:Methyltransf_16 149 233 3.6e-7 PFAM
Pfam:PrmA 166 238 2.7e-7 PFAM
low complexity region 300 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160926
SMART Domains Protein: ENSMUSP00000124826
Gene: ENSMUSG00000041406

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162949
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 T C 3: 151,542,755 V688A probably benign Het
AI661453 A G 17: 47,467,002 probably benign Het
Atp6ap1l A G 13: 90,886,723 F180S probably benign Het
Cfd G A 10: 79,891,719 V77M probably damaging Het
Col5a2 A T 1: 45,383,604 L1151H probably damaging Het
Dennd3 G A 15: 73,556,366 V854M possibly damaging Het
Dlg5 C T 14: 24,190,373 R247Q probably damaging Het
Fam3c G C 6: 22,328,670 P53A probably benign Het
Gpbp1 T C 13: 111,438,085 N302D possibly damaging Het
Hmcn1 A G 1: 150,745,033 V1142A probably benign Het
Ighv9-3 G A 12: 114,140,924 S40F probably damaging Het
Insr C T 8: 3,198,111 R478H probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Larp1 A G 11: 58,057,330 D985G probably damaging Het
Loxl3 A T 6: 83,050,664 H729L probably damaging Het
Lrrc14b T C 13: 74,360,762 M509V probably benign Het
Lrrc8e A G 8: 4,234,798 Y341C probably damaging Het
Mup12 T C 4: 60,741,309 probably benign Het
Myo1c T C 11: 75,672,201 S1020P probably benign Het
Olfr399 C A 11: 74,054,384 R125L probably damaging Het
Phkb T C 8: 86,029,546 I823T probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rpap2 T C 5: 107,603,630 probably null Het
Rpl38 T C 11: 114,668,768 probably benign Het
Scn8a T C 15: 100,974,627 F516L probably benign Het
Slc51a A T 16: 32,479,725 D71E probably damaging Het
Slco1a6 T C 6: 142,099,350 E470G possibly damaging Het
Spag17 C A 3: 100,092,950 H1811N probably benign Het
Sycp2 C T 2: 178,354,960 C1150Y probably damaging Het
Ttc12 A G 9: 49,438,418 V693A probably benign Het
Wdr83 C T 8: 85,080,149 V101I probably benign Het
Wnt3 G T 11: 103,812,585 R298L probably damaging Het
Other mutations in Mettl18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Mettl18 APN 1 163996226 missense possibly damaging 0.83
IGL01989:Mettl18 APN 1 163996303 missense probably benign 0.00
R0190:Mettl18 UTSW 1 163996422 missense probably damaging 0.98
R0394:Mettl18 UTSW 1 163996341 missense probably benign
R0562:Mettl18 UTSW 1 163996493 missense probably benign 0.04
R2260:Mettl18 UTSW 1 163996825 missense probably benign 0.28
R4293:Mettl18 UTSW 1 163996602 missense probably damaging 1.00
R4626:Mettl18 UTSW 1 163996476 missense probably damaging 1.00
R4749:Mettl18 UTSW 1 163996785 missense probably benign 0.13
R5930:Mettl18 UTSW 1 163997177 missense probably null 0.00
R5987:Mettl18 UTSW 1 163996775 missense probably benign 0.04
R6503:Mettl18 UTSW 1 163997118 missense possibly damaging 0.94
R6730:Mettl18 UTSW 1 163997181 missense probably damaging 1.00
R7457:Mettl18 UTSW 1 163996761 missense probably damaging 1.00
R8343:Mettl18 UTSW 1 163996940 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGAAATTTGCTGGGCAG -3'
(R):5'- CCGGCCACTCCTACTTAATAG -3'

Sequencing Primer
(F):5'- CAGAAAGTGTTAGACCTTGGCTG -3'
(R):5'- CATGCAAAGTGCTGTAATAATCCGG -3'
Posted On2018-07-23