Incidental Mutation 'R6687:Fam3c'
ID527824
Institutional Source Beutler Lab
Gene Symbol Fam3c
Ensembl Gene ENSMUSG00000029672
Gene Namefamily with sequence similarity 3, member C
SynonymsFam3c, D6Wsu176e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R6687 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location22306520-22356243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 22328670 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 53 (P53A)
Ref Sequence ENSEMBL: ENSMUSP00000128855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081288] [ENSMUST00000163371] [ENSMUST00000163963] [ENSMUST00000165576] [ENSMUST00000168965]
Predicted Effect probably benign
Transcript: ENSMUST00000081288
AA Change: P23A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080040
Gene: ENSMUSG00000029672
AA Change: P23A

DomainStartEndE-ValueType
PDB:2YOP|C 18 194 9e-45 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000163371
AA Change: P53A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000128855
Gene: ENSMUSG00000029672
AA Change: P53A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163963
AA Change: P73A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000127559
Gene: ENSMUSG00000029672
AA Change: P73A

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:ILEI 122 214 1.9e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164669
SMART Domains Protein: ENSMUSP00000132380
Gene: ENSMUSG00000029672

DomainStartEndE-ValueType
PDB:2YOP|C 1 152 2e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000165576
AA Change: P53A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000127709
Gene: ENSMUSG00000029672
AA Change: P53A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2YOP|C 48 224 4e-44 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000168965
AA Change: P53A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000128135
Gene: ENSMUSG00000029672
AA Change: P53A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2YOP|C 48 110 6e-10 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the family with sequence similarity 3 (FAM3) family and encodes a secreted protein with a GG domain. A change in expression of this protein has been noted in pancreatic cancer-derived cells. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out or gene trap allele exhibit normal skeletal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 T C 3: 151,542,755 V688A probably benign Het
AI661453 A G 17: 47,467,002 probably benign Het
Atp6ap1l A G 13: 90,886,723 F180S probably benign Het
Cfd G A 10: 79,891,719 V77M probably damaging Het
Col5a2 A T 1: 45,383,604 L1151H probably damaging Het
Dennd3 G A 15: 73,556,366 V854M possibly damaging Het
Dlg5 C T 14: 24,190,373 R247Q probably damaging Het
Gpbp1 T C 13: 111,438,085 N302D possibly damaging Het
Hmcn1 A G 1: 150,745,033 V1142A probably benign Het
Ighv9-3 G A 12: 114,140,924 S40F probably damaging Het
Insr C T 8: 3,198,111 R478H probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Larp1 A G 11: 58,057,330 D985G probably damaging Het
Loxl3 A T 6: 83,050,664 H729L probably damaging Het
Lrrc14b T C 13: 74,360,762 M509V probably benign Het
Lrrc8e A G 8: 4,234,798 Y341C probably damaging Het
Mettl18 A G 1: 163,996,800 D230G possibly damaging Het
Mup12 T C 4: 60,741,309 probably benign Het
Myo1c T C 11: 75,672,201 S1020P probably benign Het
Olfr399 C A 11: 74,054,384 R125L probably damaging Het
Phkb T C 8: 86,029,546 I823T probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rpap2 T C 5: 107,603,630 probably null Het
Rpl38 T C 11: 114,668,768 probably benign Het
Scn8a T C 15: 100,974,627 F516L probably benign Het
Slc51a A T 16: 32,479,725 D71E probably damaging Het
Slco1a6 T C 6: 142,099,350 E470G possibly damaging Het
Spag17 C A 3: 100,092,950 H1811N probably benign Het
Sycp2 C T 2: 178,354,960 C1150Y probably damaging Het
Ttc12 A G 9: 49,438,418 V693A probably benign Het
Wdr83 C T 8: 85,080,149 V101I probably benign Het
Wnt3 G T 11: 103,812,585 R298L probably damaging Het
Other mutations in Fam3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Fam3c APN 6 22318948 missense probably damaging 1.00
IGL01958:Fam3c APN 6 22318955 missense probably damaging 1.00
IGL02017:Fam3c APN 6 22343277 start codon destroyed probably null 0.66
PIT4812001:Fam3c UTSW 6 22321370 missense probably damaging 1.00
R1829:Fam3c UTSW 6 22309437 missense probably damaging 1.00
R2024:Fam3c UTSW 6 22329593 missense probably benign 0.33
R2884:Fam3c UTSW 6 22329582 missense probably damaging 0.98
R5481:Fam3c UTSW 6 22321358 missense probably benign 0.30
R5662:Fam3c UTSW 6 22355062 intron probably benign
R5911:Fam3c UTSW 6 22328561 missense probably damaging 1.00
R5911:Fam3c UTSW 6 22339300 missense probably benign 0.00
R6575:Fam3c UTSW 6 22329608 missense probably damaging 1.00
R6982:Fam3c UTSW 6 22322301 missense probably damaging 1.00
R7570:Fam3c UTSW 6 22326405 intron probably benign
R7777:Fam3c UTSW 6 22328574 missense probably benign 0.19
R7994:Fam3c UTSW 6 22308460 missense probably damaging 0.98
R8082:Fam3c UTSW 6 22343304 missense unknown
R8254:Fam3c UTSW 6 22328676 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GGTCTGTCACTCAATCCACG -3'
(R):5'- ATTAAAGAATGTGTGTCTCGCC -3'

Sequencing Primer
(F):5'- ACGACCTTCGAGCTCTGAG -3'
(R):5'- ATGGATGTATGCTCACCACG -3'
Posted On2018-07-23