Incidental Mutation 'R6687:Slco1a6'
ID527826
Institutional Source Beutler Lab
Gene Symbol Slco1a6
Ensembl Gene ENSMUSG00000079262
Gene Namesolute carrier organic anion transporter family, member 1a6
SynonymsSlc21a13, organic anion-transporting polypeptide, 4930422F19Rik, Oatp-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6687 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location142085761-142208521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142099350 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 470 (E470G)
Ref Sequence ENSEMBL: ENSMUSP00000107458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111827]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111827
AA Change: E470G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107458
Gene: ENSMUSG00000079262
AA Change: E470G

DomainStartEndE-ValueType
Pfam:MFS_1 21 421 7.8e-26 PFAM
Pfam:OATP 21 597 1.3e-163 PFAM
Pfam:Kazal_2 445 486 2.7e-11 PFAM
transmembrane domain 600 619 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 T C 3: 151,542,755 V688A probably benign Het
AI661453 A G 17: 47,467,002 probably benign Het
Atp6ap1l A G 13: 90,886,723 F180S probably benign Het
Cfd G A 10: 79,891,719 V77M probably damaging Het
Col5a2 A T 1: 45,383,604 L1151H probably damaging Het
Dennd3 G A 15: 73,556,366 V854M possibly damaging Het
Dlg5 C T 14: 24,190,373 R247Q probably damaging Het
Fam3c G C 6: 22,328,670 P53A probably benign Het
Gpbp1 T C 13: 111,438,085 N302D possibly damaging Het
Hmcn1 A G 1: 150,745,033 V1142A probably benign Het
Ighv9-3 G A 12: 114,140,924 S40F probably damaging Het
Insr C T 8: 3,198,111 R478H probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Larp1 A G 11: 58,057,330 D985G probably damaging Het
Loxl3 A T 6: 83,050,664 H729L probably damaging Het
Lrrc14b T C 13: 74,360,762 M509V probably benign Het
Lrrc8e A G 8: 4,234,798 Y341C probably damaging Het
Mettl18 A G 1: 163,996,800 D230G possibly damaging Het
Mup12 T C 4: 60,741,309 probably benign Het
Myo1c T C 11: 75,672,201 S1020P probably benign Het
Olfr399 C A 11: 74,054,384 R125L probably damaging Het
Phkb T C 8: 86,029,546 I823T probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rpap2 T C 5: 107,603,630 probably null Het
Rpl38 T C 11: 114,668,768 probably benign Het
Scn8a T C 15: 100,974,627 F516L probably benign Het
Slc51a A T 16: 32,479,725 D71E probably damaging Het
Spag17 C A 3: 100,092,950 H1811N probably benign Het
Sycp2 C T 2: 178,354,960 C1150Y probably damaging Het
Ttc12 A G 9: 49,438,418 V693A probably benign Het
Wdr83 C T 8: 85,080,149 V101I probably benign Het
Wnt3 G T 11: 103,812,585 R298L probably damaging Het
Other mutations in Slco1a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Slco1a6 APN 6 142161017 missense probably benign 0.00
IGL00430:Slco1a6 APN 6 142101651 nonsense probably null
IGL00541:Slco1a6 APN 6 142096299 missense possibly damaging 0.67
IGL01340:Slco1a6 APN 6 142109383 missense possibly damaging 0.71
IGL01693:Slco1a6 APN 6 142133209 nonsense probably null
IGL01713:Slco1a6 APN 6 142086567 missense possibly damaging 0.87
IGL01828:Slco1a6 APN 6 142096411 missense probably damaging 1.00
IGL02049:Slco1a6 APN 6 142101583 splice site probably benign
IGL02085:Slco1a6 APN 6 142086474 missense probably benign 0.00
IGL02245:Slco1a6 APN 6 142109424 missense probably damaging 1.00
IGL02549:Slco1a6 APN 6 142096415 splice site probably benign
IGL02698:Slco1a6 APN 6 142103011 nonsense probably null
IGL02948:Slco1a6 APN 6 142133235 splice site probably null
IGL03075:Slco1a6 APN 6 142103149 splice site probably benign
PIT4585001:Slco1a6 UTSW 6 142109520 missense probably damaging 0.99
R0008:Slco1a6 UTSW 6 142157222 unclassified probably benign
R0106:Slco1a6 UTSW 6 142157390 unclassified probably benign
R0106:Slco1a6 UTSW 6 142157390 unclassified probably benign
R0173:Slco1a6 UTSW 6 142103122 missense probably benign 0.10
R1642:Slco1a6 UTSW 6 142086434 missense probably benign 0.00
R1939:Slco1a6 UTSW 6 142133230 missense probably damaging 1.00
R2256:Slco1a6 UTSW 6 142091016 missense probably benign 0.04
R2257:Slco1a6 UTSW 6 142091016 missense probably benign 0.04
R2696:Slco1a6 UTSW 6 142112936 missense probably damaging 1.00
R2902:Slco1a6 UTSW 6 142096320 missense probably damaging 1.00
R4602:Slco1a6 UTSW 6 142101652 missense probably benign 0.00
R4611:Slco1a6 UTSW 6 142101652 missense probably benign 0.00
R4958:Slco1a6 UTSW 6 142145705 missense probably damaging 1.00
R5256:Slco1a6 UTSW 6 142132701 missense probably benign 0.39
R5347:Slco1a6 UTSW 6 142086599 missense probably damaging 0.98
R6130:Slco1a6 UTSW 6 142086429 missense probably benign 0.26
R6384:Slco1a6 UTSW 6 142109379 missense probably benign 0.01
R6543:Slco1a6 UTSW 6 142133146 missense probably benign 0.00
R6662:Slco1a6 UTSW 6 142133215 missense probably damaging 0.97
R6702:Slco1a6 UTSW 6 142103100 missense probably damaging 0.99
R7012:Slco1a6 UTSW 6 142086561 missense probably benign 0.02
R7140:Slco1a6 UTSW 6 142103019 missense probably benign 0.00
R7392:Slco1a6 UTSW 6 142157277 missense probably benign 0.00
R7399:Slco1a6 UTSW 6 142091068 missense probably benign 0.01
R7476:Slco1a6 UTSW 6 142103001 missense possibly damaging 0.71
R7621:Slco1a6 UTSW 6 142161017 missense probably damaging 0.96
R7633:Slco1a6 UTSW 6 142145755 missense probably damaging 1.00
R8139:Slco1a6 UTSW 6 142089900 missense probably damaging 1.00
R8177:Slco1a6 UTSW 6 142101734 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTCAGACTCTGTCAAGGTTTTC -3'
(R):5'- CACACATGCTGGGATGAAGG -3'

Sequencing Primer
(F):5'- CAGACTCTGTCAAGGTTTTCTATAAC -3'
(R):5'- AAGTACTTCTGTGGATTTTCTGTATC -3'
Posted On2018-07-23