Incidental Mutation 'R6687:Lrrc8e'
ID527828
Institutional Source Beutler Lab
Gene Symbol Lrrc8e
Ensembl Gene ENSMUSG00000046589
Gene Nameleucine rich repeat containing 8 family, member E
Synonyms1810049O03Rik, C87354
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6687 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location4226827-4237470 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4234798 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 341 (Y341C)
Ref Sequence ENSEMBL: ENSMUSP00000052055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003027] [ENSMUST00000053035] [ENSMUST00000062686] [ENSMUST00000110998] [ENSMUST00000110999] [ENSMUST00000145165] [ENSMUST00000207770]
Predicted Effect probably benign
Transcript: ENSMUST00000003027
SMART Domains Protein: ENSMUSP00000003027
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
low complexity region 435 455 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000053035
AA Change: Y341C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052055
Gene: ENSMUSG00000046589
AA Change: Y341C

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 330 3.8e-143 PFAM
low complexity region 504 516 N/A INTRINSIC
LRR 603 627 3.97e0 SMART
LRR 628 650 2.33e2 SMART
LRR_TYP 651 674 6.08e-5 SMART
LRR 676 696 6.78e1 SMART
LRR_TYP 697 720 2.43e-4 SMART
LRR 721 742 1.09e2 SMART
LRR_TYP 743 766 9.44e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062686
SMART Domains Protein: ENSMUSP00000054512
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110998
SMART Domains Protein: ENSMUSP00000106626
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
S_TKc 120 380 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110999
SMART Domains Protein: ENSMUSP00000106627
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
S_TKc 120 380 8.43e-72 SMART
low complexity region 419 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145165
SMART Domains Protein: ENSMUSP00000117418
Gene: ENSMUSG00000109061

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207770
Meta Mutation Damage Score 0.9425 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small, conserved family of proteins with similar structure, including a string of extracellular leucine-rich repeats. A related protein was shown to be involved in B-cell development. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 T C 3: 151,542,755 V688A probably benign Het
AI661453 A G 17: 47,467,002 probably benign Het
Atp6ap1l A G 13: 90,886,723 F180S probably benign Het
Cfd G A 10: 79,891,719 V77M probably damaging Het
Col5a2 A T 1: 45,383,604 L1151H probably damaging Het
Dennd3 G A 15: 73,556,366 V854M possibly damaging Het
Dlg5 C T 14: 24,190,373 R247Q probably damaging Het
Fam3c G C 6: 22,328,670 P53A probably benign Het
Gpbp1 T C 13: 111,438,085 N302D possibly damaging Het
Hmcn1 A G 1: 150,745,033 V1142A probably benign Het
Ighv9-3 G A 12: 114,140,924 S40F probably damaging Het
Insr C T 8: 3,198,111 R478H probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Larp1 A G 11: 58,057,330 D985G probably damaging Het
Loxl3 A T 6: 83,050,664 H729L probably damaging Het
Lrrc14b T C 13: 74,360,762 M509V probably benign Het
Mettl18 A G 1: 163,996,800 D230G possibly damaging Het
Mup12 T C 4: 60,741,309 probably benign Het
Myo1c T C 11: 75,672,201 S1020P probably benign Het
Olfr399 C A 11: 74,054,384 R125L probably damaging Het
Phkb T C 8: 86,029,546 I823T probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rpap2 T C 5: 107,603,630 probably null Het
Rpl38 T C 11: 114,668,768 probably benign Het
Scn8a T C 15: 100,974,627 F516L probably benign Het
Slc51a A T 16: 32,479,725 D71E probably damaging Het
Slco1a6 T C 6: 142,099,350 E470G possibly damaging Het
Spag17 C A 3: 100,092,950 H1811N probably benign Het
Sycp2 C T 2: 178,354,960 C1150Y probably damaging Het
Ttc12 A G 9: 49,438,418 V693A probably benign Het
Wdr83 C T 8: 85,080,149 V101I probably benign Het
Wnt3 G T 11: 103,812,585 R298L probably damaging Het
Other mutations in Lrrc8e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Lrrc8e APN 8 4235921 missense probably benign
IGL00943:Lrrc8e APN 8 4235658 missense probably damaging 1.00
IGL00979:Lrrc8e APN 8 4235080 missense probably damaging 1.00
IGL01138:Lrrc8e APN 8 4234084 missense probably damaging 1.00
IGL01458:Lrrc8e APN 8 4236141 missense probably damaging 1.00
IGL02524:Lrrc8e APN 8 4235392 missense probably damaging 1.00
IGL02831:Lrrc8e APN 8 4235429 missense probably damaging 0.96
IGL03135:Lrrc8e APN 8 4235776 missense probably damaging 1.00
R0242:Lrrc8e UTSW 8 4235401 missense probably benign 0.00
R0242:Lrrc8e UTSW 8 4235401 missense probably benign 0.00
R0312:Lrrc8e UTSW 8 4235733 missense probably benign
R0601:Lrrc8e UTSW 8 4235239 splice site probably null
R1167:Lrrc8e UTSW 8 4235337 missense probably benign
R1405:Lrrc8e UTSW 8 4231754 missense probably damaging 1.00
R1405:Lrrc8e UTSW 8 4231754 missense probably damaging 1.00
R1540:Lrrc8e UTSW 8 4234990 missense probably benign 0.41
R1677:Lrrc8e UTSW 8 4234190 missense probably damaging 1.00
R1916:Lrrc8e UTSW 8 4235202 missense probably benign 0.01
R2185:Lrrc8e UTSW 8 4234986 nonsense probably null
R2290:Lrrc8e UTSW 8 4231770 missense probably damaging 1.00
R3424:Lrrc8e UTSW 8 4234611 missense probably damaging 1.00
R4628:Lrrc8e UTSW 8 4233981 missense probably damaging 1.00
R4996:Lrrc8e UTSW 8 4235166 missense probably damaging 1.00
R5169:Lrrc8e UTSW 8 4234329 missense probably benign
R5516:Lrrc8e UTSW 8 4235818 missense probably damaging 1.00
R5870:Lrrc8e UTSW 8 4235725 missense possibly damaging 0.60
R6700:Lrrc8e UTSW 8 4236034 missense probably damaging 1.00
R7344:Lrrc8e UTSW 8 4234815 missense probably damaging 1.00
R7350:Lrrc8e UTSW 8 4235626 missense probably benign 0.14
R7555:Lrrc8e UTSW 8 4234363 missense probably benign 0.05
R7691:Lrrc8e UTSW 8 4234534 missense probably damaging 1.00
R8112:Lrrc8e UTSW 8 4235575 missense probably benign 0.14
R8184:Lrrc8e UTSW 8 4235140 missense probably damaging 0.99
R8328:Lrrc8e UTSW 8 4235641 missense probably damaging 1.00
Z1176:Lrrc8e UTSW 8 4234822 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGATCAGCTTTCTGGTGGC -3'
(R):5'- TGTTACGCTGCAGCTTCTG -3'

Sequencing Primer
(F):5'- ATCAGCTTTCTGGTGGCCTGTAG -3'
(R):5'- AGCTTCTCAGGTGTCCACTCATG -3'
Posted On2018-07-23