Incidental Mutation 'R6687:Wdr83'
ID527829
Institutional Source Beutler Lab
Gene Symbol Wdr83
Ensembl Gene ENSMUSG00000005150
Gene NameWD repeat domain containing 83
Synonyms1500041N16Rik, Morg1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6687 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location85075035-85081306 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85080149 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 101 (V101I)
Ref Sequence ENSEMBL: ENSMUSP00000122127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034121] [ENSMUST00000078665] [ENSMUST00000079764] [ENSMUST00000093357] [ENSMUST00000140621] [ENSMUST00000149050] [ENSMUST00000152785] [ENSMUST00000209264] [ENSMUST00000209361] [ENSMUST00000152871]
Predicted Effect probably benign
Transcript: ENSMUST00000034121
SMART Domains Protein: ENSMUSP00000034121
Gene: ENSMUSG00000005142

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
Pfam:Glyco_hydro_38 64 381 2.7e-96 PFAM
Alpha-mann_mid 386 465 4.25e-23 SMART
Pfam:Glyco_hydro_38C 510 1002 6.2e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078665
SMART Domains Protein: ENSMUSP00000077733
Gene: ENSMUSG00000060038

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Pfam:DS 44 354 7.1e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079764
SMART Domains Protein: ENSMUSP00000078697
Gene: ENSMUSG00000059355

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
Pfam:UPF0139 85 183 6.8e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093357
AA Change: V101I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000091048
Gene: ENSMUSG00000005150
AA Change: V101I

DomainStartEndE-ValueType
WD40 14 53 1.05e-7 SMART
WD40 56 95 8.42e-7 SMART
WD40 98 137 8.1e-9 SMART
WD40 142 179 5.52e-2 SMART
WD40 182 219 1.66e0 SMART
WD40 222 263 7e-4 SMART
WD40 266 304 4.75e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136696
Predicted Effect probably benign
Transcript: ENSMUST00000140621
SMART Domains Protein: ENSMUSP00000117962
Gene: ENSMUSG00000059355

DomainStartEndE-ValueType
Pfam:UPF0139 5 88 1.4e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142422
Predicted Effect probably benign
Transcript: ENSMUST00000149050
AA Change: V101I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000121568
Gene: ENSMUSG00000005150
AA Change: V101I

DomainStartEndE-ValueType
WD40 14 53 1.05e-7 SMART
WD40 56 95 8.42e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152785
AA Change: V101I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000122127
Gene: ENSMUSG00000005150
AA Change: V101I

DomainStartEndE-ValueType
WD40 14 53 1.05e-7 SMART
WD40 56 95 8.42e-7 SMART
WD40 140 177 5.52e-2 SMART
WD40 180 217 1.66e0 SMART
WD40 220 261 7e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152186
Predicted Effect probably benign
Transcript: ENSMUST00000209361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145880
Predicted Effect probably benign
Transcript: ENSMUST00000152871
SMART Domains Protein: ENSMUSP00000120308
Gene: ENSMUSG00000060038

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Pfam:DS 59 142 1.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211379
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD-40 protein family. The protein is proposed to function as a molecular scaffold for various multimeric protein complexes. The protein associates with several components of the extracellular signal-regulated kinase (ERK) pathway, and promotes ERK activity in response to serum or other signals. The protein also interacts with egl nine homolog 3 (EGLN3, also known as PHD3) and regulates expression of hypoxia-inducible factor 1, and has been purified as part of the spliceosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a reporter allele exhibit embryonic lethality at E10.5 due to diffuse vascularization and placental insufficiency. Mice heterozygous for the same reporter allele exhibit decreased susceptibility to kidney reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 T C 3: 151,542,755 V688A probably benign Het
AI661453 A G 17: 47,467,002 probably benign Het
Atp6ap1l A G 13: 90,886,723 F180S probably benign Het
Cfd G A 10: 79,891,719 V77M probably damaging Het
Col5a2 A T 1: 45,383,604 L1151H probably damaging Het
Dennd3 G A 15: 73,556,366 V854M possibly damaging Het
Dlg5 C T 14: 24,190,373 R247Q probably damaging Het
Fam3c G C 6: 22,328,670 P53A probably benign Het
Gpbp1 T C 13: 111,438,085 N302D possibly damaging Het
Hmcn1 A G 1: 150,745,033 V1142A probably benign Het
Ighv9-3 G A 12: 114,140,924 S40F probably damaging Het
Insr C T 8: 3,198,111 R478H probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Larp1 A G 11: 58,057,330 D985G probably damaging Het
Loxl3 A T 6: 83,050,664 H729L probably damaging Het
Lrrc14b T C 13: 74,360,762 M509V probably benign Het
Lrrc8e A G 8: 4,234,798 Y341C probably damaging Het
Mettl18 A G 1: 163,996,800 D230G possibly damaging Het
Mup12 T C 4: 60,741,309 probably benign Het
Myo1c T C 11: 75,672,201 S1020P probably benign Het
Olfr399 C A 11: 74,054,384 R125L probably damaging Het
Phkb T C 8: 86,029,546 I823T probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rpap2 T C 5: 107,603,630 probably null Het
Rpl38 T C 11: 114,668,768 probably benign Het
Scn8a T C 15: 100,974,627 F516L probably benign Het
Slc51a A T 16: 32,479,725 D71E probably damaging Het
Slco1a6 T C 6: 142,099,350 E470G possibly damaging Het
Spag17 C A 3: 100,092,950 H1811N probably benign Het
Sycp2 C T 2: 178,354,960 C1150Y probably damaging Het
Ttc12 A G 9: 49,438,418 V693A probably benign Het
Wnt3 G T 11: 103,812,585 R298L probably damaging Het
Other mutations in Wdr83
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Wdr83 APN 8 85079814 missense probably damaging 1.00
IGL01671:Wdr83 APN 8 85075819 unclassified probably benign
IGL02081:Wdr83 APN 8 85075843 missense probably benign 0.08
IGL03293:Wdr83 APN 8 85080587 missense probably benign 0.09
R0062:Wdr83 UTSW 8 85079827 missense possibly damaging 0.67
R0062:Wdr83 UTSW 8 85079827 missense possibly damaging 0.67
R3729:Wdr83 UTSW 8 85080339 missense probably damaging 1.00
R4664:Wdr83 UTSW 8 85080051 unclassified probably benign
R4758:Wdr83 UTSW 8 85075238 missense probably benign 0.25
R5456:Wdr83 UTSW 8 85080208 missense probably benign 0.00
R7078:Wdr83 UTSW 8 85076051 missense probably damaging 1.00
R7172:Wdr83 UTSW 8 85079824 missense probably damaging 0.98
R7311:Wdr83 UTSW 8 85076261 missense probably benign 0.21
R7349:Wdr83 UTSW 8 85079831 missense possibly damaging 0.59
R7449:Wdr83 UTSW 8 85079681 missense probably damaging 1.00
R7570:Wdr83 UTSW 8 85079834 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGTTAAAGCAAGGGCACATG -3'
(R):5'- GCTACGAAGTGCTAGATGCG -3'

Sequencing Primer
(F):5'- TGTTAAAGCAAGGGCACATGTTATAG -3'
(R):5'- AAGTGCTAGATGCGGCTGG -3'
Posted On2018-07-23