Incidental Mutation 'R6687:Ttc12'
ID527831
Institutional Source Beutler Lab
Gene Symbol Ttc12
Ensembl Gene ENSMUSG00000040219
Gene Nametetratricopeptide repeat domain 12
SynonymsE330017O07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R6687 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location49436963-49486225 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49438418 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 693 (V693A)
Ref Sequence ENSEMBL: ENSMUSP00000056378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055096]
Predicted Effect probably benign
Transcript: ENSMUST00000055096
AA Change: V693A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000056378
Gene: ENSMUSG00000040219
AA Change: V693A

DomainStartEndE-ValueType
coiled coil region 1 29 N/A INTRINSIC
low complexity region 88 102 N/A INTRINSIC
TPR 105 138 9.39e-1 SMART
TPR 139 172 1.97e-3 SMART
TPR 173 206 1.09e-5 SMART
low complexity region 356 368 N/A INTRINSIC
low complexity region 602 613 N/A INTRINSIC
Blast:ARM 634 675 1e-7 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 T C 3: 151,542,755 V688A probably benign Het
AI661453 A G 17: 47,467,002 probably benign Het
Atp6ap1l A G 13: 90,886,723 F180S probably benign Het
Cfd G A 10: 79,891,719 V77M probably damaging Het
Col5a2 A T 1: 45,383,604 L1151H probably damaging Het
Dennd3 G A 15: 73,556,366 V854M possibly damaging Het
Dlg5 C T 14: 24,190,373 R247Q probably damaging Het
Fam3c G C 6: 22,328,670 P53A probably benign Het
Gpbp1 T C 13: 111,438,085 N302D possibly damaging Het
Hmcn1 A G 1: 150,745,033 V1142A probably benign Het
Ighv9-3 G A 12: 114,140,924 S40F probably damaging Het
Insr C T 8: 3,198,111 R478H probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Larp1 A G 11: 58,057,330 D985G probably damaging Het
Loxl3 A T 6: 83,050,664 H729L probably damaging Het
Lrrc14b T C 13: 74,360,762 M509V probably benign Het
Lrrc8e A G 8: 4,234,798 Y341C probably damaging Het
Mettl18 A G 1: 163,996,800 D230G possibly damaging Het
Mup12 T C 4: 60,741,309 probably benign Het
Myo1c T C 11: 75,672,201 S1020P probably benign Het
Olfr399 C A 11: 74,054,384 R125L probably damaging Het
Phkb T C 8: 86,029,546 I823T probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rpap2 T C 5: 107,603,630 probably null Het
Rpl38 T C 11: 114,668,768 probably benign Het
Scn8a T C 15: 100,974,627 F516L probably benign Het
Slc51a A T 16: 32,479,725 D71E probably damaging Het
Slco1a6 T C 6: 142,099,350 E470G possibly damaging Het
Spag17 C A 3: 100,092,950 H1811N probably benign Het
Sycp2 C T 2: 178,354,960 C1150Y probably damaging Het
Wdr83 C T 8: 85,080,149 V101I probably benign Het
Wnt3 G T 11: 103,812,585 R298L probably damaging Het
Other mutations in Ttc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Ttc12 APN 9 49471206 splice site probably null
IGL01300:Ttc12 APN 9 49447922 splice site probably benign
IGL02100:Ttc12 APN 9 49440182 missense probably damaging 1.00
IGL03106:Ttc12 APN 9 49458062 missense possibly damaging 0.75
I2288:Ttc12 UTSW 9 49470258 missense possibly damaging 0.62
R1238:Ttc12 UTSW 9 49458187 splice site probably benign
R1712:Ttc12 UTSW 9 49445199 missense probably benign
R1725:Ttc12 UTSW 9 49458115 missense probably benign 0.08
R1824:Ttc12 UTSW 9 49456884 missense probably damaging 1.00
R1916:Ttc12 UTSW 9 49460398 missense probably damaging 1.00
R2226:Ttc12 UTSW 9 49441835 critical splice donor site probably null
R4498:Ttc12 UTSW 9 49472405 missense probably damaging 1.00
R5920:Ttc12 UTSW 9 49453333 missense possibly damaging 0.48
R6020:Ttc12 UTSW 9 49443122 missense probably damaging 0.96
R6755:Ttc12 UTSW 9 49453346 missense probably benign 0.00
R6975:Ttc12 UTSW 9 49438418 missense probably benign 0.08
R7349:Ttc12 UTSW 9 49447967 missense possibly damaging 0.94
R7357:Ttc12 UTSW 9 49438387 missense probably benign 0.02
R7451:Ttc12 UTSW 9 49471879 missense probably benign 0.00
R7725:Ttc12 UTSW 9 49440302 missense probably benign 0.00
R7842:Ttc12 UTSW 9 49438424 missense possibly damaging 0.80
R7943:Ttc12 UTSW 9 49470320 missense possibly damaging 0.53
R8029:Ttc12 UTSW 9 49470251 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CCGGCAGACATCCAGTTTTG -3'
(R):5'- ACACTGAGTGTTCCCAGTATTGTG -3'

Sequencing Primer
(F):5'- gtgtgCTCACAGGCTTTT -3'
(R):5'- TGTGGGTTCCCCTAGAGTCC -3'
Posted On2018-07-23