Incidental Mutation 'R6687:Olfr399'
ID527834
Institutional Source Beutler Lab
Gene Symbol Olfr399
Ensembl Gene ENSMUSG00000043692
Gene Nameolfactory receptor 399
SynonymsGA_x6K02T2P1NL-4211516-4210581, MOR255-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6687 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location74053127-74056615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 74054384 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 125 (R125L)
Ref Sequence ENSEMBL: ENSMUSP00000149917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059440] [ENSMUST00000206280] [ENSMUST00000215915]
Predicted Effect probably damaging
Transcript: ENSMUST00000059440
AA Change: R125L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000056508
Gene: ENSMUSG00000043692
AA Change: R125L

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 9.9e-55 PFAM
Pfam:7tm_1 44 293 1.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125093
Predicted Effect probably benign
Transcript: ENSMUST00000206280
Predicted Effect probably damaging
Transcript: ENSMUST00000215915
AA Change: R125L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 T C 3: 151,542,755 V688A probably benign Het
AI661453 A G 17: 47,467,002 probably benign Het
Atp6ap1l A G 13: 90,886,723 F180S probably benign Het
Cfd G A 10: 79,891,719 V77M probably damaging Het
Col5a2 A T 1: 45,383,604 L1151H probably damaging Het
Dennd3 G A 15: 73,556,366 V854M possibly damaging Het
Dlg5 C T 14: 24,190,373 R247Q probably damaging Het
Fam3c G C 6: 22,328,670 P53A probably benign Het
Gpbp1 T C 13: 111,438,085 N302D possibly damaging Het
Hmcn1 A G 1: 150,745,033 V1142A probably benign Het
Ighv9-3 G A 12: 114,140,924 S40F probably damaging Het
Insr C T 8: 3,198,111 R478H probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Larp1 A G 11: 58,057,330 D985G probably damaging Het
Loxl3 A T 6: 83,050,664 H729L probably damaging Het
Lrrc14b T C 13: 74,360,762 M509V probably benign Het
Lrrc8e A G 8: 4,234,798 Y341C probably damaging Het
Mettl18 A G 1: 163,996,800 D230G possibly damaging Het
Mup12 T C 4: 60,741,309 probably benign Het
Myo1c T C 11: 75,672,201 S1020P probably benign Het
Phkb T C 8: 86,029,546 I823T probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rpap2 T C 5: 107,603,630 probably null Het
Rpl38 T C 11: 114,668,768 probably benign Het
Scn8a T C 15: 100,974,627 F516L probably benign Het
Slc51a A T 16: 32,479,725 D71E probably damaging Het
Slco1a6 T C 6: 142,099,350 E470G possibly damaging Het
Spag17 C A 3: 100,092,950 H1811N probably benign Het
Sycp2 C T 2: 178,354,960 C1150Y probably damaging Het
Ttc12 A G 9: 49,438,418 V693A probably benign Het
Wdr83 C T 8: 85,080,149 V101I probably benign Het
Wnt3 G T 11: 103,812,585 R298L probably damaging Het
Other mutations in Olfr399
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Olfr399 APN 11 74054475 missense probably benign 0.41
R1344:Olfr399 UTSW 11 74054212 nonsense probably null
R1496:Olfr399 UTSW 11 74053824 makesense probably null
R1708:Olfr399 UTSW 11 74053988 missense probably damaging 0.99
R1911:Olfr399 UTSW 11 74054384 missense probably damaging 0.99
R2056:Olfr399 UTSW 11 74053993 nonsense probably null
R3418:Olfr399 UTSW 11 74053988 missense probably damaging 0.99
R5444:Olfr399 UTSW 11 74053977 missense probably benign 0.19
R5470:Olfr399 UTSW 11 74053907 missense possibly damaging 0.90
R6150:Olfr399 UTSW 11 74054319 missense probably benign 0.03
R6442:Olfr399 UTSW 11 74054679 missense probably benign 0.00
R7195:Olfr399 UTSW 11 74054397 missense probably damaging 1.00
R7942:Olfr399 UTSW 11 74054228 missense probably damaging 1.00
R7957:Olfr399 UTSW 11 74054156 missense probably damaging 1.00
R8052:Olfr399 UTSW 11 74054475 missense probably benign 0.41
R8190:Olfr399 UTSW 11 74054479 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAGCTGCTCATTGAGTTGG -3'
(R):5'- TGGTGGCAATTTCAGCATCC -3'

Sequencing Primer
(F):5'- CTCATTGAGTTGGATGCTGGAAC -3'
(R):5'- GCATCCTGGCTGCTATCATTATAGAG -3'
Posted On2018-07-23