Incidental Mutation 'R6687:Wnt3'
ID527836
Institutional Source Beutler Lab
Gene Symbol Wnt3
Ensembl Gene ENSMUSG00000000125
Gene Namewingless-type MMTV integration site family, member 3
SynonymsInt-4, Wnt-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6687 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location103774150-103817957 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 103812585 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 298 (R298L)
Ref Sequence ENSEMBL: ENSMUSP00000000127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000127]
Predicted Effect probably damaging
Transcript: ENSMUST00000000127
AA Change: R298L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000127
Gene: ENSMUSG00000000125
AA Change: R298L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
WNT1 47 355 1.24e-216 SMART
Meta Mutation Damage Score 0.9619 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 98% amino acid identity to mouse Wnt3 protein, and 84% to human WNT3A protein, another WNT gene product. The mouse studies show the requirement of Wnt3 in primary axis formation in the mouse. Studies of the gene expression suggest that this gene may play a key role in some cases of human breast, rectal, lung, and gastric cancer through activation of the WNT-beta-catenin-TCF signaling pathway. This gene is clustered with WNT15, another family member, in the chromosome 17q21 region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants develop to the egg cylinder stage, but fail to form a primitive streak, mesoderm, or node, and die by embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 T C 3: 151,542,755 V688A probably benign Het
AI661453 A G 17: 47,467,002 probably benign Het
Atp6ap1l A G 13: 90,886,723 F180S probably benign Het
Cfd G A 10: 79,891,719 V77M probably damaging Het
Col5a2 A T 1: 45,383,604 L1151H probably damaging Het
Dennd3 G A 15: 73,556,366 V854M possibly damaging Het
Dlg5 C T 14: 24,190,373 R247Q probably damaging Het
Fam3c G C 6: 22,328,670 P53A probably benign Het
Gpbp1 T C 13: 111,438,085 N302D possibly damaging Het
Hmcn1 A G 1: 150,745,033 V1142A probably benign Het
Ighv9-3 G A 12: 114,140,924 S40F probably damaging Het
Insr C T 8: 3,198,111 R478H probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Larp1 A G 11: 58,057,330 D985G probably damaging Het
Loxl3 A T 6: 83,050,664 H729L probably damaging Het
Lrrc14b T C 13: 74,360,762 M509V probably benign Het
Lrrc8e A G 8: 4,234,798 Y341C probably damaging Het
Mettl18 A G 1: 163,996,800 D230G possibly damaging Het
Mup12 T C 4: 60,741,309 probably benign Het
Myo1c T C 11: 75,672,201 S1020P probably benign Het
Olfr399 C A 11: 74,054,384 R125L probably damaging Het
Phkb T C 8: 86,029,546 I823T probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rpap2 T C 5: 107,603,630 probably null Het
Rpl38 T C 11: 114,668,768 probably benign Het
Scn8a T C 15: 100,974,627 F516L probably benign Het
Slc51a A T 16: 32,479,725 D71E probably damaging Het
Slco1a6 T C 6: 142,099,350 E470G possibly damaging Het
Spag17 C A 3: 100,092,950 H1811N probably benign Het
Sycp2 C T 2: 178,354,960 C1150Y probably damaging Het
Ttc12 A G 9: 49,438,418 V693A probably benign Het
Wdr83 C T 8: 85,080,149 V101I probably benign Het
Other mutations in Wnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Wnt3 APN 11 103808314 missense possibly damaging 0.81
IGL01645:Wnt3 APN 11 103812378 missense probably benign 0.00
IGL01989:Wnt3 APN 11 103812407 missense probably benign 0.44
IGL02087:Wnt3 APN 11 103812359 missense probably benign 0.34
IGL02525:Wnt3 APN 11 103812470 missense probably damaging 1.00
R0494:Wnt3 UTSW 11 103812315 missense probably damaging 1.00
R0615:Wnt3 UTSW 11 103812381 missense possibly damaging 0.68
R1438:Wnt3 UTSW 11 103808251 missense probably damaging 1.00
R2058:Wnt3 UTSW 11 103812285 missense probably damaging 0.97
R2127:Wnt3 UTSW 11 103812648 missense possibly damaging 0.82
R2128:Wnt3 UTSW 11 103812648 missense possibly damaging 0.82
R4470:Wnt3 UTSW 11 103812624 missense probably damaging 0.99
R4878:Wnt3 UTSW 11 103808205 missense possibly damaging 0.88
R5616:Wnt3 UTSW 11 103812770 critical splice donor site probably null
R6052:Wnt3 UTSW 11 103808174 nonsense probably null
R6472:Wnt3 UTSW 11 103808274 missense possibly damaging 0.89
R7652:Wnt3 UTSW 11 103812464 missense possibly damaging 0.83
R7760:Wnt3 UTSW 11 103811440 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAAGGACAAGTACGACAGTGC -3'
(R):5'- ATCAGAAGAGCAGGCCTAGC -3'

Sequencing Primer
(F):5'- TACGACAGTGCCTCCGAGATG -3'
(R):5'- CTGGCTCACTACTTGCAGGTG -3'
Posted On2018-07-23