Incidental Mutation 'R6687:Wnt3'
ID 527836
Institutional Source Beutler Lab
Gene Symbol Wnt3
Ensembl Gene ENSMUSG00000000125
Gene Name wingless-type MMTV integration site family, member 3
Synonyms Wnt-3, Int-4
MMRRC Submission 044805-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6687 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 103664976-103708783 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 103703411 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 298 (R298L)
Ref Sequence ENSEMBL: ENSMUSP00000000127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000127]
AlphaFold P17553
Predicted Effect probably damaging
Transcript: ENSMUST00000000127
AA Change: R298L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000127
Gene: ENSMUSG00000000125
AA Change: R298L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
WNT1 47 355 1.24e-216 SMART
Meta Mutation Damage Score 0.9619 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 98% amino acid identity to mouse Wnt3 protein, and 84% to human WNT3A protein, another WNT gene product. The mouse studies show the requirement of Wnt3 in primary axis formation in the mouse. Studies of the gene expression suggest that this gene may play a key role in some cases of human breast, rectal, lung, and gastric cancer through activation of the WNT-beta-catenin-TCF signaling pathway. This gene is clustered with WNT15, another family member, in the chromosome 17q21 region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants develop to the egg cylinder stage, but fail to form a primitive streak, mesoderm, or node, and die by embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 T C 3: 151,248,392 (GRCm39) V688A probably benign Het
AI661453 A G 17: 47,777,927 (GRCm39) probably benign Het
Atp6ap1l A G 13: 91,034,842 (GRCm39) F180S probably benign Het
Cfd G A 10: 79,727,553 (GRCm39) V77M probably damaging Het
Col5a2 A T 1: 45,422,764 (GRCm39) L1151H probably damaging Het
Dennd3 G A 15: 73,428,215 (GRCm39) V854M possibly damaging Het
Dlg5 C T 14: 24,240,441 (GRCm39) R247Q probably damaging Het
Fam3c G C 6: 22,328,669 (GRCm39) P53A probably benign Het
Gpbp1 T C 13: 111,574,619 (GRCm39) N302D possibly damaging Het
Hmcn1 A G 1: 150,620,784 (GRCm39) V1142A probably benign Het
Ighv9-3 G A 12: 114,104,544 (GRCm39) S40F probably damaging Het
Insr C T 8: 3,248,111 (GRCm39) R478H probably benign Het
Kcna2 C A 3: 107,012,343 (GRCm39) S308Y probably damaging Het
Larp1 A G 11: 57,948,156 (GRCm39) D985G probably damaging Het
Loxl3 A T 6: 83,027,645 (GRCm39) H729L probably damaging Het
Lrrc14b T C 13: 74,508,881 (GRCm39) M509V probably benign Het
Lrrc8e A G 8: 4,284,798 (GRCm39) Y341C probably damaging Het
Mettl18 A G 1: 163,824,369 (GRCm39) D230G possibly damaging Het
Mup12 T C 4: 60,697,308 (GRCm39) probably benign Het
Myo1c T C 11: 75,563,027 (GRCm39) S1020P probably benign Het
Or3a4 C A 11: 73,945,210 (GRCm39) R125L probably damaging Het
Phkb T C 8: 86,756,175 (GRCm39) I823T probably damaging Het
Psmb5 C A 14: 54,854,130 (GRCm39) R116L probably damaging Het
Rpap2 T C 5: 107,751,496 (GRCm39) probably null Het
Rpl38 T C 11: 114,559,594 (GRCm39) probably benign Het
Scn8a T C 15: 100,872,508 (GRCm39) F516L probably benign Het
Slc51a A T 16: 32,298,543 (GRCm39) D71E probably damaging Het
Slco1a6 T C 6: 142,045,076 (GRCm39) E470G possibly damaging Het
Spag17 C A 3: 100,000,266 (GRCm39) H1811N probably benign Het
Sycp2 C T 2: 177,996,753 (GRCm39) C1150Y probably damaging Het
Ttc12 A G 9: 49,349,718 (GRCm39) V693A probably benign Het
Wdr83 C T 8: 85,806,778 (GRCm39) V101I probably benign Het
Other mutations in Wnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Wnt3 APN 11 103,699,140 (GRCm39) missense possibly damaging 0.81
IGL01645:Wnt3 APN 11 103,703,204 (GRCm39) missense probably benign 0.00
IGL01989:Wnt3 APN 11 103,703,233 (GRCm39) missense probably benign 0.44
IGL02087:Wnt3 APN 11 103,703,185 (GRCm39) missense probably benign 0.34
IGL02525:Wnt3 APN 11 103,703,296 (GRCm39) missense probably damaging 1.00
R0494:Wnt3 UTSW 11 103,703,141 (GRCm39) missense probably damaging 1.00
R0615:Wnt3 UTSW 11 103,703,207 (GRCm39) missense possibly damaging 0.68
R1438:Wnt3 UTSW 11 103,699,077 (GRCm39) missense probably damaging 1.00
R2058:Wnt3 UTSW 11 103,703,111 (GRCm39) missense probably damaging 0.97
R2127:Wnt3 UTSW 11 103,703,474 (GRCm39) missense possibly damaging 0.82
R2128:Wnt3 UTSW 11 103,703,474 (GRCm39) missense possibly damaging 0.82
R4470:Wnt3 UTSW 11 103,703,450 (GRCm39) missense probably damaging 0.99
R4878:Wnt3 UTSW 11 103,699,031 (GRCm39) missense possibly damaging 0.88
R5616:Wnt3 UTSW 11 103,703,596 (GRCm39) critical splice donor site probably null
R6052:Wnt3 UTSW 11 103,699,000 (GRCm39) nonsense probably null
R6472:Wnt3 UTSW 11 103,699,100 (GRCm39) missense possibly damaging 0.89
R7652:Wnt3 UTSW 11 103,703,290 (GRCm39) missense possibly damaging 0.83
R7760:Wnt3 UTSW 11 103,702,266 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAAGGACAAGTACGACAGTGC -3'
(R):5'- ATCAGAAGAGCAGGCCTAGC -3'

Sequencing Primer
(F):5'- TACGACAGTGCCTCCGAGATG -3'
(R):5'- CTGGCTCACTACTTGCAGGTG -3'
Posted On 2018-07-23