Incidental Mutation 'R6687:Rpl38'
ID527837
Institutional Source Beutler Lab
Gene Symbol Rpl38
Ensembl Gene ENSMUSG00000057322
Gene Nameribosomal protein L38
SynonymsTs, Rbt, Tss, 0610025G13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6687 (G1)
Quality Score162.009
Status Validated
Chromosome11
Chromosomal Location114668524-114672331 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 114668768 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077915] [ENSMUST00000082092] [ENSMUST00000106599] [ENSMUST00000106602]
Predicted Effect probably benign
Transcript: ENSMUST00000077915
SMART Domains Protein: ENSMUSP00000102211
Gene: ENSMUSG00000057322

DomainStartEndE-ValueType
Pfam:Ribosomal_L38e 2 69 1.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082092
SMART Domains Protein: ENSMUSP00000080741
Gene: ENSMUSG00000057322

DomainStartEndE-ValueType
Pfam:Ribosomal_L38e 2 69 1.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106599
SMART Domains Protein: ENSMUSP00000102209
Gene: ENSMUSG00000057322

DomainStartEndE-ValueType
Pfam:Ribosomal_L38e 2 69 1.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106602
SMART Domains Protein: ENSMUSP00000102213
Gene: ENSMUSG00000057322

DomainStartEndE-ValueType
Pfam:Ribosomal_L38e 2 69 3.9e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120766
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L38E family of ribosomal proteins. It is located in the cytoplasm. Alternative splice variants have been identified, both encoding the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome, including one located in the promoter region of the type 1 angiotensin II receptor gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene affect growth and tail formation, and result in anterior and posterior homeotic vertebral transformations along the axial skeleton along with other abnormalities depending on genetic background. Homozygotes die in the early embryonic period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 T C 3: 151,542,755 V688A probably benign Het
AI661453 A G 17: 47,467,002 probably benign Het
Atp6ap1l A G 13: 90,886,723 F180S probably benign Het
Cfd G A 10: 79,891,719 V77M probably damaging Het
Col5a2 A T 1: 45,383,604 L1151H probably damaging Het
Dennd3 G A 15: 73,556,366 V854M possibly damaging Het
Dlg5 C T 14: 24,190,373 R247Q probably damaging Het
Fam3c G C 6: 22,328,670 P53A probably benign Het
Gpbp1 T C 13: 111,438,085 N302D possibly damaging Het
Hmcn1 A G 1: 150,745,033 V1142A probably benign Het
Ighv9-3 G A 12: 114,140,924 S40F probably damaging Het
Insr C T 8: 3,198,111 R478H probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Larp1 A G 11: 58,057,330 D985G probably damaging Het
Loxl3 A T 6: 83,050,664 H729L probably damaging Het
Lrrc14b T C 13: 74,360,762 M509V probably benign Het
Lrrc8e A G 8: 4,234,798 Y341C probably damaging Het
Mettl18 A G 1: 163,996,800 D230G possibly damaging Het
Mup12 T C 4: 60,741,309 probably benign Het
Myo1c T C 11: 75,672,201 S1020P probably benign Het
Olfr399 C A 11: 74,054,384 R125L probably damaging Het
Phkb T C 8: 86,029,546 I823T probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rpap2 T C 5: 107,603,630 probably null Het
Scn8a T C 15: 100,974,627 F516L probably benign Het
Slc51a A T 16: 32,479,725 D71E probably damaging Het
Slco1a6 T C 6: 142,099,350 E470G possibly damaging Het
Spag17 C A 3: 100,092,950 H1811N probably benign Het
Sycp2 C T 2: 178,354,960 C1150Y probably damaging Het
Ttc12 A G 9: 49,438,418 V693A probably benign Het
Wdr83 C T 8: 85,080,149 V101I probably benign Het
Wnt3 G T 11: 103,812,585 R298L probably damaging Het
Other mutations in Rpl38
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1938:Rpl38 UTSW 11 114671776 missense probably benign 0.31
R3018:Rpl38 UTSW 11 114668935 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GTCCTTTGCAGACACCGTAC -3'
(R):5'- AGCAGAAAGTCCTTGATCTCC -3'

Sequencing Primer
(F):5'- GCAGACACCGTACTCAGTTTC -3'
(R):5'- CTCAATTTTCCGAGGCTGTAACATAG -3'
Posted On2018-07-23