Incidental Mutation 'R6687:Dennd3'
ID527844
Institutional Source Beutler Lab
Gene Symbol Dennd3
Ensembl Gene ENSMUSG00000036661
Gene NameDENN/MADD domain containing 3
SynonymsE030003N15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R6687 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location73512560-73572242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73556366 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 854 (V854M)
Ref Sequence ENSEMBL: ENSMUSP00000134002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043414] [ENSMUST00000160267] [ENSMUST00000173292]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043414
AA Change: V854M

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000046774
Gene: ENSMUSG00000036661
AA Change: V854M

DomainStartEndE-ValueType
Blast:uDENN 12 161 3e-78 BLAST
DENN 187 373 1.54e-62 SMART
dDENN 436 499 6.81e-14 SMART
WD40 1015 1054 3.68e1 SMART
WD40 1057 1098 3.32e-5 SMART
WD40 1232 1272 1.1e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160267
SMART Domains Protein: ENSMUSP00000124538
Gene: ENSMUSG00000036661

DomainStartEndE-ValueType
Blast:WD40 51 90 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162488
SMART Domains Protein: ENSMUSP00000125657
Gene: ENSMUSG00000036661

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Blast:DENN 33 104 5e-28 BLAST
DENN 116 302 1.54e-62 SMART
dDENN 312 376 5.63e-6 SMART
WD40 892 931 3.68e1 SMART
WD40 934 975 3.32e-5 SMART
WD40 1109 1149 1.1e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000173292
AA Change: V854M

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134002
Gene: ENSMUSG00000036661
AA Change: V854M

DomainStartEndE-ValueType
Blast:uDENN 12 161 2e-78 BLAST
DENN 187 373 1.54e-62 SMART
dDENN 436 499 6.81e-14 SMART
WD40 1015 1054 3.68e1 SMART
WD40 1057 1098 3.32e-5 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 T C 3: 151,542,755 V688A probably benign Het
AI661453 A G 17: 47,467,002 probably benign Het
Atp6ap1l A G 13: 90,886,723 F180S probably benign Het
Cfd G A 10: 79,891,719 V77M probably damaging Het
Col5a2 A T 1: 45,383,604 L1151H probably damaging Het
Dlg5 C T 14: 24,190,373 R247Q probably damaging Het
Fam3c G C 6: 22,328,670 P53A probably benign Het
Gpbp1 T C 13: 111,438,085 N302D possibly damaging Het
Hmcn1 A G 1: 150,745,033 V1142A probably benign Het
Ighv9-3 G A 12: 114,140,924 S40F probably damaging Het
Insr C T 8: 3,198,111 R478H probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Larp1 A G 11: 58,057,330 D985G probably damaging Het
Loxl3 A T 6: 83,050,664 H729L probably damaging Het
Lrrc14b T C 13: 74,360,762 M509V probably benign Het
Lrrc8e A G 8: 4,234,798 Y341C probably damaging Het
Mettl18 A G 1: 163,996,800 D230G possibly damaging Het
Mup12 T C 4: 60,741,309 probably benign Het
Myo1c T C 11: 75,672,201 S1020P probably benign Het
Olfr399 C A 11: 74,054,384 R125L probably damaging Het
Phkb T C 8: 86,029,546 I823T probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rpap2 T C 5: 107,603,630 probably null Het
Rpl38 T C 11: 114,668,768 probably benign Het
Scn8a T C 15: 100,974,627 F516L probably benign Het
Slc51a A T 16: 32,479,725 D71E probably damaging Het
Slco1a6 T C 6: 142,099,350 E470G possibly damaging Het
Spag17 C A 3: 100,092,950 H1811N probably benign Het
Sycp2 C T 2: 178,354,960 C1150Y probably damaging Het
Ttc12 A G 9: 49,438,418 V693A probably benign Het
Wdr83 C T 8: 85,080,149 V101I probably benign Het
Wnt3 G T 11: 103,812,585 R298L probably damaging Het
Other mutations in Dennd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dennd3 APN 15 73567133 missense probably benign 0.26
IGL00579:Dennd3 APN 15 73540842 missense possibly damaging 0.63
IGL02101:Dennd3 APN 15 73527945 missense possibly damaging 0.81
IGL02164:Dennd3 APN 15 73544448 missense probably benign 0.26
IGL02389:Dennd3 APN 15 73567056 missense probably damaging 1.00
IGL02604:Dennd3 APN 15 73556403 missense probably damaging 1.00
IGL02697:Dennd3 APN 15 73524236 missense possibly damaging 0.82
IGL02885:Dennd3 APN 15 73568696 missense probably benign
IGL03356:Dennd3 APN 15 73568633 missense probably benign 0.19
IGL03388:Dennd3 APN 15 73544359 missense probably damaging 0.98
BB006:Dennd3 UTSW 15 73564574 missense probably damaging 1.00
BB016:Dennd3 UTSW 15 73564574 missense probably damaging 1.00
R0118:Dennd3 UTSW 15 73565076 missense probably damaging 1.00
R0925:Dennd3 UTSW 15 73533435 missense probably damaging 1.00
R1076:Dennd3 UTSW 15 73540733 missense probably damaging 1.00
R1355:Dennd3 UTSW 15 73540854 splice site probably benign
R1370:Dennd3 UTSW 15 73540854 splice site probably benign
R1480:Dennd3 UTSW 15 73532846 missense probably benign 0.20
R1727:Dennd3 UTSW 15 73565128 missense possibly damaging 0.95
R1732:Dennd3 UTSW 15 73537418 splice site probably benign
R1771:Dennd3 UTSW 15 73555101 missense possibly damaging 0.71
R1776:Dennd3 UTSW 15 73555101 missense possibly damaging 0.71
R1779:Dennd3 UTSW 15 73522508 critical splice donor site probably null
R1838:Dennd3 UTSW 15 73565100 missense probably damaging 1.00
R2146:Dennd3 UTSW 15 73523496 missense probably damaging 1.00
R2146:Dennd3 UTSW 15 73555060 missense probably benign 0.35
R2147:Dennd3 UTSW 15 73523487 missense probably damaging 1.00
R2148:Dennd3 UTSW 15 73555060 missense probably benign 0.35
R2149:Dennd3 UTSW 15 73555060 missense probably benign 0.35
R2150:Dennd3 UTSW 15 73555060 missense probably benign 0.35
R2174:Dennd3 UTSW 15 73555305 missense probably damaging 1.00
R2295:Dennd3 UTSW 15 73523555 critical splice donor site probably null
R2905:Dennd3 UTSW 15 73557646 missense probably damaging 1.00
R3106:Dennd3 UTSW 15 73565124 nonsense probably null
R3757:Dennd3 UTSW 15 73522234 missense probably benign 0.00
R3785:Dennd3 UTSW 15 73547577 missense possibly damaging 0.89
R3786:Dennd3 UTSW 15 73547577 missense possibly damaging 0.89
R3787:Dennd3 UTSW 15 73547577 missense possibly damaging 0.89
R3847:Dennd3 UTSW 15 73542732 missense possibly damaging 0.64
R4369:Dennd3 UTSW 15 73540809 missense probably damaging 0.98
R4601:Dennd3 UTSW 15 73567160 missense probably damaging 0.99
R4666:Dennd3 UTSW 15 73570860 missense probably damaging 1.00
R4680:Dennd3 UTSW 15 73533376 missense possibly damaging 0.82
R4708:Dennd3 UTSW 15 73523495 missense probably damaging 1.00
R4789:Dennd3 UTSW 15 73522282 missense probably damaging 1.00
R4920:Dennd3 UTSW 15 73540725 missense probably benign 0.13
R5043:Dennd3 UTSW 15 73527936 missense probably benign 0.00
R5074:Dennd3 UTSW 15 73547295 missense probably damaging 1.00
R5410:Dennd3 UTSW 15 73547448 missense probably benign 0.02
R5421:Dennd3 UTSW 15 73567115 missense probably benign
R5560:Dennd3 UTSW 15 73532895 missense probably damaging 1.00
R6008:Dennd3 UTSW 15 73567080 missense possibly damaging 0.88
R6357:Dennd3 UTSW 15 73556472 missense possibly damaging 0.49
R6563:Dennd3 UTSW 15 73544380 missense probably damaging 0.98
R6837:Dennd3 UTSW 15 73557693 missense probably damaging 1.00
R6910:Dennd3 UTSW 15 73555116 missense probably benign 0.01
R7125:Dennd3 UTSW 15 73533291 missense possibly damaging 0.50
R7297:Dennd3 UTSW 15 73557610 missense probably damaging 1.00
R7524:Dennd3 UTSW 15 73524246 nonsense probably null
R7580:Dennd3 UTSW 15 73556447 missense possibly damaging 0.89
R7653:Dennd3 UTSW 15 73562426 missense probably damaging 0.99
R7731:Dennd3 UTSW 15 73562367 missense probably damaging 0.99
R7767:Dennd3 UTSW 15 73522230 missense probably benign
R7806:Dennd3 UTSW 15 73570775 missense possibly damaging 0.87
R7860:Dennd3 UTSW 15 73540808 missense probably damaging 0.97
R7902:Dennd3 UTSW 15 73568115 critical splice donor site probably benign
R7929:Dennd3 UTSW 15 73564574 missense probably damaging 1.00
R8218:Dennd3 UTSW 15 73512773 missense probably benign 0.31
RF006:Dennd3 UTSW 15 73547592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGTCCCTGCCTGACTTG -3'
(R):5'- CTTCCAAGTGCTGCAAGCTC -3'

Sequencing Primer
(F):5'- TGCCTGACTTGCCAGCTG -3'
(R):5'- CAAGTGCTGCAAGCTCTGGATG -3'
Posted On2018-07-23