Incidental Mutation 'R6687:AI661453'
ID527847
Institutional Source Beutler Lab
Gene Symbol AI661453
Ensembl Gene ENSMUSG00000034382
Gene Nameexpressed sequence AI661453
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6687 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location47436615-47470638 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 47467002 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037701] [ENSMUST00000150819]
Predicted Effect probably benign
Transcript: ENSMUST00000037701
SMART Domains Protein: ENSMUSP00000045345
Gene: ENSMUSG00000034382

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 157 180 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000150819
AA Change: D551G
SMART Domains Protein: ENSMUSP00000120133
Gene: ENSMUSG00000034382
AA Change: D551G

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 157 237 N/A INTRINSIC
low complexity region 294 312 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
low complexity region 354 364 N/A INTRINSIC
low complexity region 384 423 N/A INTRINSIC
low complexity region 429 444 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 612 627 N/A INTRINSIC
internal_repeat_1 628 654 6.24e-9 PROSPERO
low complexity region 656 671 N/A INTRINSIC
internal_repeat_1 688 714 6.24e-9 PROSPERO
low complexity region 853 863 N/A INTRINSIC
low complexity region 976 1016 N/A INTRINSIC
low complexity region 1147 1154 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 T C 3: 151,542,755 V688A probably benign Het
Atp6ap1l A G 13: 90,886,723 F180S probably benign Het
Cfd G A 10: 79,891,719 V77M probably damaging Het
Col5a2 A T 1: 45,383,604 L1151H probably damaging Het
Dennd3 G A 15: 73,556,366 V854M possibly damaging Het
Dlg5 C T 14: 24,190,373 R247Q probably damaging Het
Fam3c G C 6: 22,328,670 P53A probably benign Het
Gpbp1 T C 13: 111,438,085 N302D possibly damaging Het
Hmcn1 A G 1: 150,745,033 V1142A probably benign Het
Ighv9-3 G A 12: 114,140,924 S40F probably damaging Het
Insr C T 8: 3,198,111 R478H probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Larp1 A G 11: 58,057,330 D985G probably damaging Het
Loxl3 A T 6: 83,050,664 H729L probably damaging Het
Lrrc14b T C 13: 74,360,762 M509V probably benign Het
Lrrc8e A G 8: 4,234,798 Y341C probably damaging Het
Mettl18 A G 1: 163,996,800 D230G possibly damaging Het
Mup12 T C 4: 60,741,309 probably benign Het
Myo1c T C 11: 75,672,201 S1020P probably benign Het
Olfr399 C A 11: 74,054,384 R125L probably damaging Het
Phkb T C 8: 86,029,546 I823T probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rpap2 T C 5: 107,603,630 probably null Het
Rpl38 T C 11: 114,668,768 probably benign Het
Scn8a T C 15: 100,974,627 F516L probably benign Het
Slc51a A T 16: 32,479,725 D71E probably damaging Het
Slco1a6 T C 6: 142,099,350 E470G possibly damaging Het
Spag17 C A 3: 100,092,950 H1811N probably benign Het
Sycp2 C T 2: 178,354,960 C1150Y probably damaging Het
Ttc12 A G 9: 49,438,418 V693A probably benign Het
Wdr83 C T 8: 85,080,149 V101I probably benign Het
Wnt3 G T 11: 103,812,585 R298L probably damaging Het
Other mutations in AI661453
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:AI661453 APN 17 47466623 intron probably benign
IGL01995:AI661453 APN 17 47468517 intron probably benign
IGL02171:AI661453 APN 17 47466996 intron probably benign
IGL02411:AI661453 APN 17 47467338 intron probably benign
IGL02422:AI661453 APN 17 47467092 intron probably benign
IGL02609:AI661453 APN 17 47468372 intron probably benign
IGL02888:AI661453 APN 17 47467404 intron probably benign
IGL03024:AI661453 APN 17 47446588 missense probably damaging 1.00
R0077:AI661453 UTSW 17 47469362 intron probably benign
R0092:AI661453 UTSW 17 47467515 intron probably benign
R0144:AI661453 UTSW 17 47469299 intron probably benign
R0330:AI661453 UTSW 17 47446646 missense probably damaging 1.00
R0590:AI661453 UTSW 17 47467074 intron probably benign
R0839:AI661453 UTSW 17 47436827 missense probably null 0.97
R1350:AI661453 UTSW 17 47467928 nonsense probably null
R1436:AI661453 UTSW 17 47466702 intron probably benign
R1439:AI661453 UTSW 17 47466662 intron probably benign
R1643:AI661453 UTSW 17 47467866 intron probably benign
R1994:AI661453 UTSW 17 47467034 intron probably benign
R2145:AI661453 UTSW 17 47466098 intron probably benign
R2986:AI661453 UTSW 17 47466772 nonsense probably null
R4398:AI661453 UTSW 17 47468117 intron probably benign
R4809:AI661453 UTSW 17 47467187 intron probably benign
R4913:AI661453 UTSW 17 47468555 nonsense probably null
R4972:AI661453 UTSW 17 47466399 intron probably benign
R6430:AI661453 UTSW 17 47466797 intron probably benign
R7494:AI661453 UTSW 17 47468180 missense unknown
R7598:AI661453 UTSW 17 47466120 missense unknown
R7635:AI661453 UTSW 17 47467751 missense unknown
R7753:AI661453 UTSW 17 47467514 nonsense probably null
R7920:AI661453 UTSW 17 47468406 missense unknown
R7974:AI661453 UTSW 17 47466081 missense unknown
R8022:AI661453 UTSW 17 47466236 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTCTGTGGGACCAGGAAAG -3'
(R):5'- GGCAGGCTTATGGAATCTGC -3'

Sequencing Primer
(F):5'- AAGAGGATCGGTCACTCAGCC -3'
(R):5'- GCAGGCTTATGGAATCTGCCATTATC -3'
Posted On2018-07-23