Incidental Mutation 'R6688:Kif5c'
ID527848
Institutional Source Beutler Lab
Gene Symbol Kif5c
Ensembl Gene ENSMUSG00000026764
Gene Namekinesin family member 5C
SynonymsKhc
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6688 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location49619298-49774778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49688737 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 126 (N126D)
Ref Sequence ENSEMBL: ENSMUSP00000028102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028102]
PDB Structure
Crystal Structure of the Kif1A Motor Domain Complexed With Mg-AMPPNP [X-RAY DIFFRACTION]
Crystal Structure of the Kif1A Motor Domain Complexed With Mg-AMPPNP [X-RAY DIFFRACTION]
Crystal Structure of the Kif1A Motor Domain Complexed With ADP-Mg-AlFx [X-RAY DIFFRACTION]
Crystal Structure of the Kif1A Motor Domain Complexed With ADP-Mg-VO4 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028102
AA Change: N126D

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000028102
Gene: ENSMUSG00000026764
AA Change: N126D

DomainStartEndE-ValueType
KISc 6 335 2.8e-173 SMART
low complexity region 340 357 N/A INTRINSIC
coiled coil region 407 541 N/A INTRINSIC
coiled coil region 592 803 N/A INTRINSIC
coiled coil region 826 915 N/A INTRINSIC
Meta Mutation Damage Score 0.0979 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinesin heavy chain subunit involved in the transport of cargo within the central nervous system. The encoded protein, which acts as a tetramer by associating with another heavy chain and two light chains, interacts with protein kinase CK2. Mutations in this gene have been associated with complex cortical dysplasia with other brain malformations-2. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homezygous for disruptions in this gene are viable, fertile, and of normal size. The brain is normal but slightly reduced in size with decreased numbers of motor neurons an somewhat more sensory nerves than normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn1 A T 13: 45,567,671 H249Q probably damaging Het
Cd22 A C 7: 30,872,964 S362A possibly damaging Het
Cep120 G A 18: 53,724,536 P286S probably benign Het
Ces1g G A 8: 93,306,972 P441S possibly damaging Het
Ces2h A G 8: 105,017,840 I316V probably benign Het
Cntnap5c T A 17: 58,293,904 D747E possibly damaging Het
Cwf19l2 T C 9: 3,450,015 V572A probably benign Het
Cyb5rl C T 4: 107,073,905 A128V probably damaging Het
Dnttip1 T C 2: 164,765,161 Y241H probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Golga4 A G 9: 118,514,210 T11A possibly damaging Het
Ip6k2 C A 9: 108,806,011 T440K probably benign Het
Mdn1 T A 4: 32,774,041 F5551I possibly damaging Het
Myh11 A G 16: 14,205,553 L1587P probably damaging Het
Nop53 A G 7: 15,945,854 V67A possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 T C 5: 27,744,137 T1045A probably benign Het
Pdzd3 C T 9: 44,248,230 probably null Het
Plg A T 17: 12,391,845 H215L probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rapgef2 T A 3: 79,069,128 Q1307L probably benign Het
Serpini2 T C 3: 75,259,563 E129G possibly damaging Het
Stx1b C T 7: 127,807,896 R209Q probably damaging Het
Tcf20 A G 15: 82,854,535 I905T possibly damaging Het
Tmem252 G A 19: 24,674,099 A11T probably benign Het
Tpst2 A G 5: 112,307,757 N54S probably benign Het
Usp31 T C 7: 121,678,330 S269G probably benign Het
Wasf1 T C 10: 40,926,620 probably null Het
Zfp429 A T 13: 67,396,130 V58D probably damaging Het
Zfp958 A G 8: 4,628,940 T322A possibly damaging Het
Other mutations in Kif5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Kif5c APN 2 49694816 missense possibly damaging 0.81
IGL01432:Kif5c APN 2 49701077 missense probably damaging 1.00
IGL01459:Kif5c APN 2 49735557 missense probably benign 0.36
IGL02127:Kif5c APN 2 49701110 splice site probably null
IGL03088:Kif5c APN 2 49744443 missense probably benign 0.01
IGL03379:Kif5c APN 2 49701092 missense probably damaging 0.97
IGL02988:Kif5c UTSW 2 49619717 missense probably damaging 0.97
PIT4131001:Kif5c UTSW 2 49694032 missense probably damaging 0.99
PIT4469001:Kif5c UTSW 2 49741348 missense probably benign 0.00
R0017:Kif5c UTSW 2 49732713 missense probably benign
R0017:Kif5c UTSW 2 49732713 missense probably benign
R0116:Kif5c UTSW 2 49752239 splice site probably benign
R0550:Kif5c UTSW 2 49758912 missense possibly damaging 0.53
R0760:Kif5c UTSW 2 49688753 missense probably damaging 1.00
R0967:Kif5c UTSW 2 49698116 unclassified probably benign
R1015:Kif5c UTSW 2 49744365 missense probably benign 0.13
R1758:Kif5c UTSW 2 49723133 missense probably benign 0.00
R1786:Kif5c UTSW 2 49758805 splice site probably benign
R1828:Kif5c UTSW 2 49680240 critical splice donor site probably null
R2130:Kif5c UTSW 2 49758805 splice site probably benign
R2132:Kif5c UTSW 2 49758805 splice site probably benign
R2237:Kif5c UTSW 2 49694008 missense probably benign 0.35
R3970:Kif5c UTSW 2 49688744 missense probably damaging 1.00
R4439:Kif5c UTSW 2 49688725 missense possibly damaging 0.90
R5260:Kif5c UTSW 2 49735590 missense probably damaging 0.99
R5318:Kif5c UTSW 2 49671828 missense probably benign
R5345:Kif5c UTSW 2 49723066 missense probably benign
R5490:Kif5c UTSW 2 49758858 missense probably benign
R5496:Kif5c UTSW 2 49730190 missense possibly damaging 0.69
R5567:Kif5c UTSW 2 49730199 missense possibly damaging 0.64
R5570:Kif5c UTSW 2 49730199 missense possibly damaging 0.64
R6019:Kif5c UTSW 2 49735509 missense probably benign 0.09
R7006:Kif5c UTSW 2 49735514 missense probably damaging 0.97
R7009:Kif5c UTSW 2 49757429 missense probably benign
R7081:Kif5c UTSW 2 49741361 missense probably benign 0.00
R7372:Kif5c UTSW 2 49758659 intron probably null
R7512:Kif5c UTSW 2 49700965 missense probably damaging 1.00
R7549:Kif5c UTSW 2 49701093 missense probably benign 0.11
R7764:Kif5c UTSW 2 49727961 critical splice donor site probably null
R7764:Kif5c UTSW 2 49749327 missense probably damaging 1.00
R7904:Kif5c UTSW 2 49701083 missense probably damaging 1.00
R7987:Kif5c UTSW 2 49701083 missense probably damaging 1.00
R8292:Kif5c UTSW 2 49735485 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACACACTCAACTTGGAGTTTTACAG -3'
(R):5'- GTTCCTACTGCAAGCATCCC -3'

Sequencing Primer
(F):5'- ACTTGGAGTTTTACAGATTAAACGAC -3'
(R):5'- GTTCCTACTGCAAGCATCCCAAATG -3'
Posted On2018-07-23