Incidental Mutation 'R6688:Dnttip1'
ID527849
Institutional Source Beutler Lab
Gene Symbol Dnttip1
Ensembl Gene ENSMUSG00000017299
Gene Namedeoxynucleotidyltransferase, terminal, interacting protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6688 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location164745983-164768607 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 164765161 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 241 (Y241H)
Ref Sequence ENSEMBL: ENSMUSP00000017443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001439] [ENSMUST00000017443] [ENSMUST00000088248] [ENSMUST00000109327]
Predicted Effect probably benign
Transcript: ENSMUST00000001439
SMART Domains Protein: ENSMUSP00000001439
Gene: ENSMUSG00000001403

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
UBCc 33 170 8.8e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000017443
AA Change: Y241H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017443
Gene: ENSMUSG00000017299
AA Change: Y241H

DomainStartEndE-ValueType
low complexity region 10 30 N/A INTRINSIC
Blast:UBCc 91 157 4e-16 BLAST
low complexity region 158 172 N/A INTRINSIC
Blast:UBCc 248 287 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000088248
SMART Domains Protein: ENSMUSP00000085581
Gene: ENSMUSG00000001403

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
UBCc 33 175 1.88e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109327
SMART Domains Protein: ENSMUSP00000104950
Gene: ENSMUSG00000017299

DomainStartEndE-ValueType
low complexity region 10 30 N/A INTRINSIC
Blast:UBCc 91 157 8e-17 BLAST
low complexity region 158 172 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157601
Meta Mutation Damage Score 0.8120 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNTTIP1 binds DNA and enhances the activity of terminal deoxynucleotidyltransferase (TDT, or DNTT; MIM 187410), a DNA polymerase that catalyzes the polymerization of DNA in the absence of a DNA template (Yamashita et al., 2001 [PubMed 11473582]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn1 A T 13: 45,567,671 H249Q probably damaging Het
Cd22 A C 7: 30,872,964 S362A possibly damaging Het
Cep120 G A 18: 53,724,536 P286S probably benign Het
Ces1g G A 8: 93,306,972 P441S possibly damaging Het
Ces2h A G 8: 105,017,840 I316V probably benign Het
Cntnap5c T A 17: 58,293,904 D747E possibly damaging Het
Cwf19l2 T C 9: 3,450,015 V572A probably benign Het
Cyb5rl C T 4: 107,073,905 A128V probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Golga4 A G 9: 118,514,210 T11A possibly damaging Het
Ip6k2 C A 9: 108,806,011 T440K probably benign Het
Kif5c A G 2: 49,688,737 N126D probably benign Het
Mdn1 T A 4: 32,774,041 F5551I possibly damaging Het
Myh11 A G 16: 14,205,553 L1587P probably damaging Het
Nop53 A G 7: 15,945,854 V67A possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 T C 5: 27,744,137 T1045A probably benign Het
Pdzd3 C T 9: 44,248,230 probably null Het
Plg A T 17: 12,391,845 H215L probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rapgef2 T A 3: 79,069,128 Q1307L probably benign Het
Serpini2 T C 3: 75,259,563 E129G possibly damaging Het
Stx1b C T 7: 127,807,896 R209Q probably damaging Het
Tcf20 A G 15: 82,854,535 I905T possibly damaging Het
Tmem252 G A 19: 24,674,099 A11T probably benign Het
Tpst2 A G 5: 112,307,757 N54S probably benign Het
Usp31 T C 7: 121,678,330 S269G probably benign Het
Wasf1 T C 10: 40,926,620 probably null Het
Zfp429 A T 13: 67,396,130 V58D probably damaging Het
Zfp958 A G 8: 4,628,940 T322A possibly damaging Het
Other mutations in Dnttip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4410:Dnttip1 UTSW 2 164767819 unclassified probably benign
R5991:Dnttip1 UTSW 2 164754180 missense possibly damaging 0.69
R7363:Dnttip1 UTSW 2 164757685 frame shift probably null
R7547:Dnttip1 UTSW 2 164767879 missense probably benign 0.10
R7665:Dnttip1 UTSW 2 164754141 missense probably damaging 0.96
R7904:Dnttip1 UTSW 2 164747552 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGAACTCTGGCAACTAGGTTG -3'
(R):5'- TTCAGCATGAAGGAGCAGGTC -3'

Sequencing Primer
(F):5'- AACTAGGTTGCCACCCCAGG -3'
(R):5'- AAGGAGCAGGTCTCAGGCC -3'
Posted On2018-07-23