Incidental Mutation 'R6688:Serpini2'
ID527850
Institutional Source Beutler Lab
Gene Symbol Serpini2
Ensembl Gene ENSMUSG00000034139
Gene Nameserine (or cysteine) peptidase inhibitor, clade I, member 2
Synonyms1810006A24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6688 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location75242370-75270078 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75259563 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 129 (E129G)
Ref Sequence ENSEMBL: ENSMUSP00000046943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039047]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039047
AA Change: E129G

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046943
Gene: ENSMUSG00000034139
AA Change: E129G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 31 392 8.75e-130 SMART
Meta Mutation Damage Score 0.1652 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a member of a family of proteins that acts as inhibitors of serine proteases. These proteins function in the regulation of a variety of physiological processes, including coagulation, fibrinolysis, development, malignancy, and inflammation. Expression of the encoded protein may be downregulated during pancreatic carcinogenesis. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgene insertion/deletion encompassing this gene display pancreatic insufficiency characterized by progressive apoptosis of pancreatic acinar cells, postnatal growth retardation, immunological anomalies, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn1 A T 13: 45,567,671 H249Q probably damaging Het
Cd22 A C 7: 30,872,964 S362A possibly damaging Het
Cep120 G A 18: 53,724,536 P286S probably benign Het
Ces1g G A 8: 93,306,972 P441S possibly damaging Het
Ces2h A G 8: 105,017,840 I316V probably benign Het
Cntnap5c T A 17: 58,293,904 D747E possibly damaging Het
Cwf19l2 T C 9: 3,450,015 V572A probably benign Het
Cyb5rl C T 4: 107,073,905 A128V probably damaging Het
Dnttip1 T C 2: 164,765,161 Y241H probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Golga4 A G 9: 118,514,210 T11A possibly damaging Het
Ip6k2 C A 9: 108,806,011 T440K probably benign Het
Kif5c A G 2: 49,688,737 N126D probably benign Het
Mdn1 T A 4: 32,774,041 F5551I possibly damaging Het
Myh11 A G 16: 14,205,553 L1587P probably damaging Het
Nop53 A G 7: 15,945,854 V67A possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 T C 5: 27,744,137 T1045A probably benign Het
Pdzd3 C T 9: 44,248,230 probably null Het
Plg A T 17: 12,391,845 H215L probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rapgef2 T A 3: 79,069,128 Q1307L probably benign Het
Stx1b C T 7: 127,807,896 R209Q probably damaging Het
Tcf20 A G 15: 82,854,535 I905T possibly damaging Het
Tmem252 G A 19: 24,674,099 A11T probably benign Het
Tpst2 A G 5: 112,307,757 N54S probably benign Het
Usp31 T C 7: 121,678,330 S269G probably benign Het
Wasf1 T C 10: 40,926,620 probably null Het
Zfp429 A T 13: 67,396,130 V58D probably damaging Het
Zfp958 A G 8: 4,628,940 T322A possibly damaging Het
Other mutations in Serpini2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Serpini2 APN 3 75249242 missense probably damaging 1.00
IGL00736:Serpini2 APN 3 75267809 missense possibly damaging 0.70
IGL03398:Serpini2 APN 3 75259545 missense probably benign 0.00
R0271:Serpini2 UTSW 3 75246578 missense probably damaging 1.00
R0545:Serpini2 UTSW 3 75258138 missense probably benign 0.04
R2309:Serpini2 UTSW 3 75259690 missense probably damaging 0.99
R2435:Serpini2 UTSW 3 75258168 missense probably benign 0.00
R2886:Serpini2 UTSW 3 75259614 missense probably damaging 1.00
R5054:Serpini2 UTSW 3 75259477 missense probably damaging 1.00
R5151:Serpini2 UTSW 3 75246513 missense possibly damaging 0.93
R5554:Serpini2 UTSW 3 75267988 start gained probably benign
R5614:Serpini2 UTSW 3 75257707 intron probably benign
R6413:Serpini2 UTSW 3 75259614 missense probably damaging 1.00
R6510:Serpini2 UTSW 3 75252568 missense probably damaging 0.97
R7178:Serpini2 UTSW 3 75258148 missense probably damaging 1.00
R8491:Serpini2 UTSW 3 75252515 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCAATGGGAAAACATTCAGCC -3'
(R):5'- GTGACATAAAGCCAAGAAGCTATTG -3'

Sequencing Primer
(F):5'- TGGGAAAACATTCAGCCACTCTTTAC -3'
(R):5'- AAGCCAAGAAGCTATTGTTTTTGGG -3'
Posted On2018-07-23