Incidental Mutation 'R6688:Mdn1'
ID 527852
Institutional Source Beutler Lab
Gene Symbol Mdn1
Ensembl Gene ENSMUSG00000058006
Gene Name midasin AAA ATPase 1
Synonyms 4833432B22Rik, LOC213784, D4Abb1e
MMRRC Submission 044806-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6688 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 32657119-32775217 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 32774041 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 5551 (F5551I)
Ref Sequence ENSEMBL: ENSMUSP00000136222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071642] [ENSMUST00000178134]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000071642
AA Change: F5558I

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000071569
Gene: ENSMUSG00000058006
AA Change: F5558I

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 7.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4672 4681 N/A INTRINSIC
low complexity region 4735 4756 N/A INTRINSIC
low complexity region 4769 4790 N/A INTRINSIC
low complexity region 4886 4905 N/A INTRINSIC
low complexity region 4924 4937 N/A INTRINSIC
coiled coil region 4957 4983 N/A INTRINSIC
low complexity region 5000 5017 N/A INTRINSIC
low complexity region 5176 5192 N/A INTRINSIC
low complexity region 5315 5329 N/A INTRINSIC
VWA 5375 5556 2.73e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125323
Predicted Effect possibly damaging
Transcript: ENSMUST00000178134
AA Change: F5551I

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136222
Gene: ENSMUSG00000058006
AA Change: F5551I

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 4.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4667 4676 N/A INTRINSIC
low complexity region 4730 4751 N/A INTRINSIC
low complexity region 4764 4785 N/A INTRINSIC
low complexity region 4881 4900 N/A INTRINSIC
low complexity region 4919 4932 N/A INTRINSIC
coiled coil region 4952 4978 N/A INTRINSIC
low complexity region 4992 5010 N/A INTRINSIC
low complexity region 5169 5185 N/A INTRINSIC
low complexity region 5308 5322 N/A INTRINSIC
VWA 5368 5549 2.73e-6 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
Allele List at MGI

All alleles(29) : Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn1 A T 13: 45,567,671 (GRCm38) H249Q probably damaging Het
Cd22 A C 7: 30,872,964 (GRCm38) S362A possibly damaging Het
Cep120 G A 18: 53,724,536 (GRCm38) P286S probably benign Het
Ces1g G A 8: 93,306,972 (GRCm38) P441S possibly damaging Het
Ces2h A G 8: 105,017,840 (GRCm38) I316V probably benign Het
Cntnap5c T A 17: 58,293,904 (GRCm38) D747E possibly damaging Het
Cwf19l2 T C 9: 3,450,015 (GRCm38) V572A probably benign Het
Cyb5rl C T 4: 107,073,905 (GRCm38) A128V probably damaging Het
Dnttip1 T C 2: 164,765,161 (GRCm38) Y241H probably damaging Het
Gm2381 G A 7: 42,820,586 (GRCm38) A38V probably benign Het
Golga4 A G 9: 118,514,210 (GRCm38) T11A possibly damaging Het
Ip6k2 C A 9: 108,806,011 (GRCm38) T440K probably benign Het
Kif5c A G 2: 49,688,737 (GRCm38) N126D probably benign Het
Myh11 A G 16: 14,205,553 (GRCm38) L1587P probably damaging Het
Nop53 A G 7: 15,945,854 (GRCm38) V67A possibly damaging Het
Olfr107 G A 17: 37,405,905 (GRCm38) R119H probably benign Het
Paxip1 T C 5: 27,744,137 (GRCm38) T1045A probably benign Het
Pdzd3 C T 9: 44,248,230 (GRCm38) probably null Het
Plg A T 17: 12,391,845 (GRCm38) H215L probably damaging Het
Psmb5 C A 14: 54,616,673 (GRCm38) R116L probably damaging Het
Rapgef2 T A 3: 79,069,128 (GRCm38) Q1307L probably benign Het
Serpini2 T C 3: 75,259,563 (GRCm38) E129G possibly damaging Het
Stx1b C T 7: 127,807,896 (GRCm38) R209Q probably damaging Het
Tcf20 A G 15: 82,854,535 (GRCm38) I905T possibly damaging Het
Tmem252 G A 19: 24,674,099 (GRCm38) A11T probably benign Het
Tpst2 A G 5: 112,307,757 (GRCm38) N54S probably benign Het
Usp31 T C 7: 121,678,330 (GRCm38) S269G probably benign Het
Wasf1 T C 10: 40,926,620 (GRCm38) probably null Het
Zfp429 A T 13: 67,396,130 (GRCm38) V58D probably damaging Het
Zfp958 A G 8: 4,628,940 (GRCm38) T322A possibly damaging Het
Other mutations in Mdn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Mdn1 APN 4 32,723,651 (GRCm38) missense probably damaging 1.00
IGL00426:Mdn1 APN 4 32,719,214 (GRCm38) missense possibly damaging 0.91
IGL00570:Mdn1 APN 4 32,735,719 (GRCm38) missense probably benign
IGL00573:Mdn1 APN 4 32,666,619 (GRCm38) critical splice donor site probably null
IGL00983:Mdn1 APN 4 32,735,525 (GRCm38) missense probably damaging 1.00
IGL01288:Mdn1 APN 4 32,730,864 (GRCm38) missense probably benign 0.00
IGL01359:Mdn1 APN 4 32,743,686 (GRCm38) missense probably benign 0.10
IGL01457:Mdn1 APN 4 32,715,922 (GRCm38) missense possibly damaging 0.82
IGL01530:Mdn1 APN 4 32,711,938 (GRCm38) splice site probably benign
IGL01684:Mdn1 APN 4 32,726,857 (GRCm38) missense probably benign
IGL01753:Mdn1 APN 4 32,708,483 (GRCm38) missense probably benign
IGL01901:Mdn1 APN 4 32,669,591 (GRCm38) missense probably damaging 1.00
IGL01952:Mdn1 APN 4 32,723,657 (GRCm38) missense possibly damaging 0.82
IGL01960:Mdn1 APN 4 32,758,393 (GRCm38) missense probably benign 0.14
IGL02019:Mdn1 APN 4 32,749,948 (GRCm38) missense possibly damaging 0.93
IGL02100:Mdn1 APN 4 32,715,708 (GRCm38) missense possibly damaging 0.90
IGL02117:Mdn1 APN 4 32,709,364 (GRCm38) missense probably benign 0.00
IGL02154:Mdn1 APN 4 32,740,395 (GRCm38) missense probably benign 0.35
IGL02216:Mdn1 APN 4 32,739,092 (GRCm38) missense probably benign 0.03
IGL02371:Mdn1 APN 4 32,676,860 (GRCm38) splice site probably benign
IGL02396:Mdn1 APN 4 32,700,120 (GRCm38) missense probably damaging 0.99
IGL02454:Mdn1 APN 4 32,694,674 (GRCm38) critical splice donor site probably null
IGL02502:Mdn1 APN 4 32,670,579 (GRCm38) missense possibly damaging 0.69
IGL02883:Mdn1 APN 4 32,763,199 (GRCm38) missense probably benign 0.05
IGL02946:Mdn1 APN 4 32,734,366 (GRCm38) missense probably damaging 0.98
IGL02950:Mdn1 APN 4 32,713,360 (GRCm38) splice site probably benign
IGL03076:Mdn1 APN 4 32,735,564 (GRCm38) missense probably damaging 0.97
IGL03129:Mdn1 APN 4 32,729,994 (GRCm38) missense possibly damaging 0.47
IGL03234:Mdn1 APN 4 32,732,842 (GRCm38) missense probably benign 0.06
3-1:Mdn1 UTSW 4 32,725,967 (GRCm38) critical splice donor site probably null
IGL03046:Mdn1 UTSW 4 32,694,495 (GRCm38) missense possibly damaging 0.73
P0035:Mdn1 UTSW 4 32,749,934 (GRCm38) missense probably benign 0.05
PIT4508001:Mdn1 UTSW 4 32,719,223 (GRCm38) missense probably damaging 0.97
PIT4618001:Mdn1 UTSW 4 32,746,527 (GRCm38) missense probably benign 0.20
R0008:Mdn1 UTSW 4 32,718,317 (GRCm38) missense possibly damaging 0.47
R0110:Mdn1 UTSW 4 32,738,619 (GRCm38) missense probably benign 0.20
R0125:Mdn1 UTSW 4 32,729,956 (GRCm38) missense probably damaging 0.98
R0257:Mdn1 UTSW 4 32,693,534 (GRCm38) missense probably damaging 0.99
R0266:Mdn1 UTSW 4 32,741,835 (GRCm38) missense probably damaging 0.99
R0349:Mdn1 UTSW 4 32,750,318 (GRCm38) missense probably damaging 1.00
R0362:Mdn1 UTSW 4 32,746,439 (GRCm38) critical splice acceptor site probably null
R0421:Mdn1 UTSW 4 32,684,707 (GRCm38) missense probably benign 0.39
R0450:Mdn1 UTSW 4 32,738,619 (GRCm38) missense probably benign 0.20
R0465:Mdn1 UTSW 4 32,699,204 (GRCm38) splice site probably benign
R0469:Mdn1 UTSW 4 32,738,619 (GRCm38) missense probably benign 0.20
R0477:Mdn1 UTSW 4 32,750,928 (GRCm38) missense probably benign 0.02
R0481:Mdn1 UTSW 4 32,767,182 (GRCm38) splice site probably benign
R0504:Mdn1 UTSW 4 32,698,916 (GRCm38) splice site probably benign
R0522:Mdn1 UTSW 4 32,672,837 (GRCm38) missense probably benign 0.09
R0550:Mdn1 UTSW 4 32,730,479 (GRCm38) missense probably benign 0.13
R0607:Mdn1 UTSW 4 32,732,829 (GRCm38) missense probably benign 0.36
R0607:Mdn1 UTSW 4 32,712,014 (GRCm38) missense probably damaging 1.00
R0664:Mdn1 UTSW 4 32,768,011 (GRCm38) nonsense probably null
R0701:Mdn1 UTSW 4 32,699,263 (GRCm38) missense probably benign 0.00
R0801:Mdn1 UTSW 4 32,668,895 (GRCm38) missense probably benign 0.04
R0841:Mdn1 UTSW 4 32,752,032 (GRCm38) missense probably benign 0.23
R0849:Mdn1 UTSW 4 32,741,835 (GRCm38) missense probably damaging 0.99
R0893:Mdn1 UTSW 4 32,701,713 (GRCm38) missense probably benign 0.01
R1114:Mdn1 UTSW 4 32,746,568 (GRCm38) critical splice donor site probably null
R1137:Mdn1 UTSW 4 32,694,511 (GRCm38) missense probably damaging 1.00
R1185:Mdn1 UTSW 4 32,735,576 (GRCm38) missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32,735,576 (GRCm38) missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32,735,576 (GRCm38) missense possibly damaging 0.94
R1257:Mdn1 UTSW 4 32,667,089 (GRCm38) critical splice acceptor site probably null
R1356:Mdn1 UTSW 4 32,700,334 (GRCm38) splice site probably benign
R1466:Mdn1 UTSW 4 32,730,788 (GRCm38) missense probably benign 0.28
R1466:Mdn1 UTSW 4 32,730,788 (GRCm38) missense probably benign 0.28
R1518:Mdn1 UTSW 4 32,739,977 (GRCm38) missense probably damaging 1.00
R1569:Mdn1 UTSW 4 32,723,501 (GRCm38) missense probably null 0.10
R1574:Mdn1 UTSW 4 32,722,315 (GRCm38) missense probably benign
R1574:Mdn1 UTSW 4 32,722,315 (GRCm38) missense probably benign
R1591:Mdn1 UTSW 4 32,700,092 (GRCm38) missense possibly damaging 0.65
R1678:Mdn1 UTSW 4 32,663,050 (GRCm38) missense probably damaging 0.99
R1696:Mdn1 UTSW 4 32,700,417 (GRCm38) missense possibly damaging 0.91
R1707:Mdn1 UTSW 4 32,693,504 (GRCm38) missense probably damaging 1.00
R1749:Mdn1 UTSW 4 32,773,952 (GRCm38) missense probably damaging 1.00
R1780:Mdn1 UTSW 4 32,700,103 (GRCm38) missense probably damaging 1.00
R1833:Mdn1 UTSW 4 32,720,761 (GRCm38) missense probably damaging 0.97
R1858:Mdn1 UTSW 4 32,730,881 (GRCm38) missense probably benign 0.17
R1870:Mdn1 UTSW 4 32,763,339 (GRCm38) missense probably damaging 1.00
R1887:Mdn1 UTSW 4 32,742,540 (GRCm38) missense probably damaging 1.00
R1909:Mdn1 UTSW 4 32,760,839 (GRCm38) small deletion probably benign
R2075:Mdn1 UTSW 4 32,716,058 (GRCm38) missense probably benign 0.03
R2103:Mdn1 UTSW 4 32,738,712 (GRCm38) missense possibly damaging 0.75
R2104:Mdn1 UTSW 4 32,743,843 (GRCm38) splice site probably null
R2110:Mdn1 UTSW 4 32,700,409 (GRCm38) missense probably damaging 1.00
R2111:Mdn1 UTSW 4 32,700,409 (GRCm38) missense probably damaging 1.00
R2206:Mdn1 UTSW 4 32,716,271 (GRCm38) missense possibly damaging 0.71
R2221:Mdn1 UTSW 4 32,763,306 (GRCm38) missense probably benign 0.37
R2240:Mdn1 UTSW 4 32,765,701 (GRCm38) missense possibly damaging 0.90
R2351:Mdn1 UTSW 4 32,750,010 (GRCm38) missense probably benign 0.21
R2421:Mdn1 UTSW 4 32,723,621 (GRCm38) missense probably damaging 0.96
R3036:Mdn1 UTSW 4 32,750,013 (GRCm38) missense probably damaging 0.99
R3434:Mdn1 UTSW 4 32,733,726 (GRCm38) critical splice donor site probably null
R3435:Mdn1 UTSW 4 32,733,726 (GRCm38) critical splice donor site probably null
R3783:Mdn1 UTSW 4 32,720,818 (GRCm38) missense probably benign 0.01
R3811:Mdn1 UTSW 4 32,693,506 (GRCm38) nonsense probably null
R3973:Mdn1 UTSW 4 32,722,363 (GRCm38) missense probably benign 0.00
R4154:Mdn1 UTSW 4 32,707,475 (GRCm38) missense probably damaging 0.96
R4372:Mdn1 UTSW 4 32,743,809 (GRCm38) missense probably benign 0.03
R4393:Mdn1 UTSW 4 32,754,482 (GRCm38) missense possibly damaging 0.48
R4438:Mdn1 UTSW 4 32,704,635 (GRCm38) missense probably damaging 1.00
R4471:Mdn1 UTSW 4 32,668,860 (GRCm38) missense probably benign 0.00
R4509:Mdn1 UTSW 4 32,715,883 (GRCm38) missense probably damaging 1.00
R4538:Mdn1 UTSW 4 32,722,334 (GRCm38) missense probably damaging 1.00
R4557:Mdn1 UTSW 4 32,754,437 (GRCm38) missense probably damaging 1.00
R4570:Mdn1 UTSW 4 32,741,812 (GRCm38) missense probably damaging 1.00
R4591:Mdn1 UTSW 4 32,707,636 (GRCm38) missense probably damaging 1.00
R4658:Mdn1 UTSW 4 32,730,749 (GRCm38) splice site probably null
R4667:Mdn1 UTSW 4 32,679,572 (GRCm38) missense probably damaging 1.00
R4684:Mdn1 UTSW 4 32,666,430 (GRCm38) missense probably damaging 1.00
R4778:Mdn1 UTSW 4 32,683,583 (GRCm38) nonsense probably null
R4807:Mdn1 UTSW 4 32,685,651 (GRCm38) splice site probably null
R4923:Mdn1 UTSW 4 32,671,608 (GRCm38) missense possibly damaging 0.89
R4951:Mdn1 UTSW 4 32,707,459 (GRCm38) missense probably damaging 1.00
R4963:Mdn1 UTSW 4 32,756,512 (GRCm38) missense probably benign 0.00
R4971:Mdn1 UTSW 4 32,739,827 (GRCm38) missense probably damaging 1.00
R4973:Mdn1 UTSW 4 32,734,418 (GRCm38) missense probably benign 0.01
R5122:Mdn1 UTSW 4 32,670,593 (GRCm38) missense probably damaging 1.00
R5159:Mdn1 UTSW 4 32,774,008 (GRCm38) missense possibly damaging 0.93
R5164:Mdn1 UTSW 4 32,759,011 (GRCm38) splice site probably null
R5215:Mdn1 UTSW 4 32,741,418 (GRCm38) missense possibly damaging 0.78
R5217:Mdn1 UTSW 4 32,723,690 (GRCm38) missense probably damaging 0.98
R5219:Mdn1 UTSW 4 32,723,690 (GRCm38) missense probably damaging 0.98
R5365:Mdn1 UTSW 4 32,723,690 (GRCm38) missense probably damaging 0.98
R5366:Mdn1 UTSW 4 32,723,690 (GRCm38) missense probably damaging 0.98
R5368:Mdn1 UTSW 4 32,723,690 (GRCm38) missense probably damaging 0.98
R5445:Mdn1 UTSW 4 32,723,690 (GRCm38) missense probably damaging 0.98
R5462:Mdn1 UTSW 4 32,720,897 (GRCm38) missense probably benign
R5522:Mdn1 UTSW 4 32,685,783 (GRCm38) missense probably damaging 1.00
R5525:Mdn1 UTSW 4 32,767,961 (GRCm38) missense possibly damaging 0.73
R5578:Mdn1 UTSW 4 32,728,167 (GRCm38) missense probably benign 0.04
R5605:Mdn1 UTSW 4 32,765,664 (GRCm38) missense probably benign
R5621:Mdn1 UTSW 4 32,716,371 (GRCm38) missense possibly damaging 0.46
R5636:Mdn1 UTSW 4 32,695,480 (GRCm38) missense probably damaging 1.00
R5650:Mdn1 UTSW 4 32,667,467 (GRCm38) splice site probably null
R5780:Mdn1 UTSW 4 32,722,950 (GRCm38) missense probably benign 0.02
R5838:Mdn1 UTSW 4 32,754,547 (GRCm38) missense probably damaging 0.99
R5857:Mdn1 UTSW 4 32,670,646 (GRCm38) missense probably benign 0.09
R5895:Mdn1 UTSW 4 32,695,400 (GRCm38) missense probably damaging 1.00
R5943:Mdn1 UTSW 4 32,678,330 (GRCm38) missense probably damaging 1.00
R6008:Mdn1 UTSW 4 32,741,073 (GRCm38) missense probably damaging 1.00
R6013:Mdn1 UTSW 4 32,715,713 (GRCm38) missense probably damaging 1.00
R6075:Mdn1 UTSW 4 32,689,581 (GRCm38) missense possibly damaging 0.48
R6151:Mdn1 UTSW 4 32,684,735 (GRCm38) missense probably damaging 1.00
R6163:Mdn1 UTSW 4 32,716,040 (GRCm38) missense probably damaging 1.00
R6181:Mdn1 UTSW 4 32,715,953 (GRCm38) missense probably damaging 1.00
R6211:Mdn1 UTSW 4 32,696,269 (GRCm38) missense probably benign 0.12
R6249:Mdn1 UTSW 4 32,708,484 (GRCm38) missense possibly damaging 0.85
R6251:Mdn1 UTSW 4 32,748,590 (GRCm38) missense probably benign 0.13
R6253:Mdn1 UTSW 4 32,749,593 (GRCm38) missense probably benign 0.25
R6273:Mdn1 UTSW 4 32,715,979 (GRCm38) missense probably benign 0.01
R6297:Mdn1 UTSW 4 32,730,054 (GRCm38) nonsense probably null
R6384:Mdn1 UTSW 4 32,670,607 (GRCm38) missense probably damaging 1.00
R6463:Mdn1 UTSW 4 32,773,308 (GRCm38) missense probably damaging 1.00
R6528:Mdn1 UTSW 4 32,713,780 (GRCm38) missense probably damaging 1.00
R6762:Mdn1 UTSW 4 32,676,786 (GRCm38) missense possibly damaging 0.50
R6794:Mdn1 UTSW 4 32,741,893 (GRCm38) missense probably damaging 1.00
R6894:Mdn1 UTSW 4 32,748,614 (GRCm38) missense possibly damaging 0.75
R6935:Mdn1 UTSW 4 32,774,041 (GRCm38) missense possibly damaging 0.74
R6980:Mdn1 UTSW 4 32,726,942 (GRCm38) critical splice donor site probably null
R6995:Mdn1 UTSW 4 32,733,374 (GRCm38) missense probably benign 0.03
R7048:Mdn1 UTSW 4 32,767,969 (GRCm38) missense probably benign 0.00
R7082:Mdn1 UTSW 4 32,762,341 (GRCm38) missense probably benign
R7158:Mdn1 UTSW 4 32,725,121 (GRCm38) missense probably benign 0.09
R7166:Mdn1 UTSW 4 32,746,446 (GRCm38) missense probably damaging 1.00
R7168:Mdn1 UTSW 4 32,719,184 (GRCm38) missense probably damaging 1.00
R7175:Mdn1 UTSW 4 32,694,634 (GRCm38) missense probably damaging 1.00
R7195:Mdn1 UTSW 4 32,701,823 (GRCm38) missense probably damaging 1.00
R7250:Mdn1 UTSW 4 32,695,427 (GRCm38) missense probably damaging 1.00
R7274:Mdn1 UTSW 4 32,725,944 (GRCm38) missense probably benign 0.12
R7330:Mdn1 UTSW 4 32,723,685 (GRCm38) missense probably benign 0.16
R7363:Mdn1 UTSW 4 32,691,729 (GRCm38) missense probably damaging 0.99
R7369:Mdn1 UTSW 4 32,773,375 (GRCm38) missense probably damaging 0.99
R7452:Mdn1 UTSW 4 32,739,030 (GRCm38) missense possibly damaging 0.87
R7523:Mdn1 UTSW 4 32,667,270 (GRCm38) critical splice acceptor site probably null
R7594:Mdn1 UTSW 4 32,696,359 (GRCm38) missense probably benign 0.27
R7605:Mdn1 UTSW 4 32,694,599 (GRCm38) missense probably damaging 1.00
R7661:Mdn1 UTSW 4 32,691,229 (GRCm38) missense probably benign 0.08
R7689:Mdn1 UTSW 4 32,739,912 (GRCm38) missense probably damaging 1.00
R7699:Mdn1 UTSW 4 32,741,344 (GRCm38) missense probably damaging 1.00
R7700:Mdn1 UTSW 4 32,741,344 (GRCm38) missense probably damaging 1.00
R7714:Mdn1 UTSW 4 32,722,360 (GRCm38) missense possibly damaging 0.75
R7718:Mdn1 UTSW 4 32,718,420 (GRCm38) missense probably damaging 1.00
R7762:Mdn1 UTSW 4 32,734,421 (GRCm38) missense probably benign
R7787:Mdn1 UTSW 4 32,741,794 (GRCm38) missense probably damaging 1.00
R8111:Mdn1 UTSW 4 32,674,003 (GRCm38) missense possibly damaging 0.81
R8222:Mdn1 UTSW 4 32,707,477 (GRCm38) missense probably benign 0.09
R8246:Mdn1 UTSW 4 32,657,284 (GRCm38) missense probably benign 0.06
R8267:Mdn1 UTSW 4 32,742,485 (GRCm38) missense possibly damaging 0.82
R8286:Mdn1 UTSW 4 32,731,960 (GRCm38) missense possibly damaging 0.91
R8305:Mdn1 UTSW 4 32,725,107 (GRCm38) missense probably benign
R8318:Mdn1 UTSW 4 32,735,897 (GRCm38) critical splice donor site probably null
R8379:Mdn1 UTSW 4 32,756,453 (GRCm38) missense probably null 1.00
R8384:Mdn1 UTSW 4 32,765,680 (GRCm38) missense probably benign 0.05
R8514:Mdn1 UTSW 4 32,739,857 (GRCm38) missense probably damaging 1.00
R8560:Mdn1 UTSW 4 32,743,830 (GRCm38) missense probably benign 0.08
R8672:Mdn1 UTSW 4 32,768,793 (GRCm38) missense probably damaging 1.00
R8708:Mdn1 UTSW 4 32,725,854 (GRCm38) missense probably damaging 1.00
R8769:Mdn1 UTSW 4 32,751,390 (GRCm38) missense probably damaging 0.97
R8896:Mdn1 UTSW 4 32,678,328 (GRCm38) missense probably benign 0.28
R8918:Mdn1 UTSW 4 32,744,579 (GRCm38) nonsense probably null
R8920:Mdn1 UTSW 4 32,719,280 (GRCm38) missense probably damaging 1.00
R8966:Mdn1 UTSW 4 32,672,837 (GRCm38) nonsense probably null
R8997:Mdn1 UTSW 4 32,773,275 (GRCm38) missense probably damaging 1.00
R9120:Mdn1 UTSW 4 32,701,814 (GRCm38) missense probably damaging 1.00
R9129:Mdn1 UTSW 4 32,676,812 (GRCm38) missense probably benign 0.24
R9131:Mdn1 UTSW 4 32,762,275 (GRCm38) missense possibly damaging 0.69
R9200:Mdn1 UTSW 4 32,760,791 (GRCm38) missense probably benign 0.00
R9226:Mdn1 UTSW 4 32,694,612 (GRCm38) missense probably benign 0.25
R9235:Mdn1 UTSW 4 32,739,122 (GRCm38) missense probably benign 0.10
R9293:Mdn1 UTSW 4 32,707,579 (GRCm38) missense probably damaging 1.00
R9315:Mdn1 UTSW 4 32,760,911 (GRCm38) missense probably benign 0.00
R9338:Mdn1 UTSW 4 32,666,536 (GRCm38) missense probably benign 0.00
R9353:Mdn1 UTSW 4 32,693,504 (GRCm38) missense probably damaging 1.00
R9393:Mdn1 UTSW 4 32,713,825 (GRCm38) missense
R9420:Mdn1 UTSW 4 32,678,414 (GRCm38) missense probably damaging 1.00
R9475:Mdn1 UTSW 4 32,739,849 (GRCm38) missense possibly damaging 0.65
R9583:Mdn1 UTSW 4 32,741,372 (GRCm38) missense probably damaging 1.00
R9600:Mdn1 UTSW 4 32,684,723 (GRCm38) nonsense probably null
R9640:Mdn1 UTSW 4 32,754,539 (GRCm38) missense probably damaging 1.00
R9688:Mdn1 UTSW 4 32,745,590 (GRCm38) missense probably damaging 1.00
R9744:Mdn1 UTSW 4 32,715,711 (GRCm38) missense possibly damaging 0.91
X0066:Mdn1 UTSW 4 32,739,030 (GRCm38) missense probably damaging 1.00
Z1176:Mdn1 UTSW 4 32,696,244 (GRCm38) missense probably damaging 1.00
Z1176:Mdn1 UTSW 4 32,668,944 (GRCm38) missense probably damaging 1.00
Z1176:Mdn1 UTSW 4 32,667,102 (GRCm38) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCTCCATGGCATAAAGAGCTG -3'
(R):5'- AGCTCTGAGTTCACAAACAGC -3'

Sequencing Primer
(F):5'- GCATAAAGAGCTGCCTTCTTC -3'
(R):5'- CTGAGTTCACAAACAGCTGTGTAAG -3'
Posted On 2018-07-23