Incidental Mutation 'R6688:Cyb5rl'
ID527853
Institutional Source Beutler Lab
Gene Symbol Cyb5rl
Ensembl Gene ENSMUSG00000028621
Gene Namecytochrome b5 reductase-like
Synonyms2810410C14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R6688 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location107066988-107088268 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 107073905 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 128 (A128V)
Ref Sequence ENSEMBL: ENSMUSP00000102371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030364] [ENSMUST00000106756] [ENSMUST00000106758] [ENSMUST00000106760] [ENSMUST00000137269] [ENSMUST00000145324] [ENSMUST00000149453] [ENSMUST00000154283]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030364
AA Change: A128V

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030364
Gene: ENSMUSG00000028621
AA Change: A128V

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 15 56 1e-10 PFAM
Pfam:FAD_binding_6 80 156 2.3e-11 PFAM
Pfam:NAD_binding_1 152 266 1.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106756
AA Change: A68V

PolyPhen 2 Score 0.396 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102367
Gene: ENSMUSG00000028621
AA Change: A68V

DomainStartEndE-ValueType
Pfam:FAD_binding_6 20 117 4.7e-23 PFAM
Pfam:NAD_binding_1 127 241 3.2e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106758
AA Change: A128V

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102369
Gene: ENSMUSG00000028621
AA Change: A128V

DomainStartEndE-ValueType
Pfam:Oxidored-like 10 55 1.7e-15 PFAM
Pfam:FAD_binding_6 80 177 8.2e-25 PFAM
Pfam:NAD_binding_1 187 301 8.8e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106760
AA Change: A128V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102371
Gene: ENSMUSG00000028621
AA Change: A128V

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 15 56 2.5e-14 PFAM
Pfam:FAD_binding_6 80 156 3.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126207
SMART Domains Protein: ENSMUSP00000116114
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
Pfam:Oxidored-like 4 49 1.3e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000137269
AA Change: A61V

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119249
Gene: ENSMUSG00000028621
AA Change: A61V

DomainStartEndE-ValueType
Pfam:FAD_binding_6 13 110 7.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145324
SMART Domains Protein: ENSMUSP00000122502
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 14 56 3.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149453
SMART Domains Protein: ENSMUSP00000121581
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 14 56 5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154283
SMART Domains Protein: ENSMUSP00000119366
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 14 56 4.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156406
Meta Mutation Damage Score 0.4531 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn1 A T 13: 45,567,671 H249Q probably damaging Het
Cd22 A C 7: 30,872,964 S362A possibly damaging Het
Cep120 G A 18: 53,724,536 P286S probably benign Het
Ces1g G A 8: 93,306,972 P441S possibly damaging Het
Ces2h A G 8: 105,017,840 I316V probably benign Het
Cntnap5c T A 17: 58,293,904 D747E possibly damaging Het
Cwf19l2 T C 9: 3,450,015 V572A probably benign Het
Dnttip1 T C 2: 164,765,161 Y241H probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Golga4 A G 9: 118,514,210 T11A possibly damaging Het
Ip6k2 C A 9: 108,806,011 T440K probably benign Het
Kif5c A G 2: 49,688,737 N126D probably benign Het
Mdn1 T A 4: 32,774,041 F5551I possibly damaging Het
Myh11 A G 16: 14,205,553 L1587P probably damaging Het
Nop53 A G 7: 15,945,854 V67A possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 T C 5: 27,744,137 T1045A probably benign Het
Pdzd3 C T 9: 44,248,230 probably null Het
Plg A T 17: 12,391,845 H215L probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rapgef2 T A 3: 79,069,128 Q1307L probably benign Het
Serpini2 T C 3: 75,259,563 E129G possibly damaging Het
Stx1b C T 7: 127,807,896 R209Q probably damaging Het
Tcf20 A G 15: 82,854,535 I905T possibly damaging Het
Tmem252 G A 19: 24,674,099 A11T probably benign Het
Tpst2 A G 5: 112,307,757 N54S probably benign Het
Usp31 T C 7: 121,678,330 S269G probably benign Het
Wasf1 T C 10: 40,926,620 probably null Het
Zfp429 A T 13: 67,396,130 V58D probably damaging Het
Zfp958 A G 8: 4,628,940 T322A possibly damaging Het
Other mutations in Cyb5rl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Cyb5rl APN 4 107084296 missense probably benign 0.21
IGL01350:Cyb5rl APN 4 107084212 missense possibly damaging 0.77
IGL02418:Cyb5rl APN 4 107070985 missense probably damaging 1.00
IGL02746:Cyb5rl APN 4 107068639 missense probably benign 0.12
IGL03088:Cyb5rl APN 4 107081028 nonsense probably null
IGL03279:Cyb5rl APN 4 107084128 missense possibly damaging 0.95
R1301:Cyb5rl UTSW 4 107080907 missense probably damaging 1.00
R1731:Cyb5rl UTSW 4 107080913 missense probably damaging 1.00
R2091:Cyb5rl UTSW 4 107071006 missense probably damaging 1.00
R2165:Cyb5rl UTSW 4 107068683 missense probably damaging 1.00
R2504:Cyb5rl UTSW 4 107080945 missense probably benign 0.01
R4223:Cyb5rl UTSW 4 107080988 missense probably damaging 0.97
R4851:Cyb5rl UTSW 4 107084313 missense probably benign 0.39
R4964:Cyb5rl UTSW 4 107069132 intron probably benign
R5797:Cyb5rl UTSW 4 107084207 missense possibly damaging 0.69
R6575:Cyb5rl UTSW 4 107085353 missense probably benign 0.20
R6986:Cyb5rl UTSW 4 107070876 missense probably benign 0.18
R7097:Cyb5rl UTSW 4 107087316 missense unknown
R7139:Cyb5rl UTSW 4 107071011 missense probably benign 0.35
R7293:Cyb5rl UTSW 4 107080946 missense probably damaging 0.98
R7920:Cyb5rl UTSW 4 107071008 missense possibly damaging 0.60
R8234:Cyb5rl UTSW 4 107068738 missense probably damaging 1.00
R8333:Cyb5rl UTSW 4 107068678 missense probably benign 0.03
R8367:Cyb5rl UTSW 4 107070949 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTACCTGTCCCTTGCTGAGG -3'
(R):5'- CGAGTTCATAGCACCTTACAGAATC -3'

Sequencing Primer
(F):5'- CTTGCTGAGGACAATGTCATTC -3'
(R):5'- AAGGTCCTGAGTTCAATTCCCAG -3'
Posted On2018-07-23