Incidental Mutation 'R6688:Nop53'
ID527857
Institutional Source Beutler Lab
Gene Symbol Nop53
Ensembl Gene ENSMUSG00000041560
Gene NameNOP53 ribosome biogenesis factor
SynonymsGltscr2, 9430097C02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R6688 (G1)
Quality Score143.008
Status Validated
Chromosome7
Chromosomal Location15936183-15946074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15945854 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 67 (V67A)
Ref Sequence ENSEMBL: ENSMUSP00000043981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044158] [ENSMUST00000098799]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044158
AA Change: V67A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043981
Gene: ENSMUSG00000041560
AA Change: V67A

DomainStartEndE-ValueType
Pfam:Nop53 41 451 6e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098799
SMART Domains Protein: ENSMUSP00000096397
Gene: ENSMUSG00000074364

DomainStartEndE-ValueType
Pfam:EHD_N 24 56 4.1e-19 PFAM
Pfam:MMR_HSR1 60 220 2.2e-7 PFAM
Pfam:Dynamin_N 61 221 2.4e-14 PFAM
EH 443 536 2.96e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175508
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198688
SMART Domains Protein: ENSMUSP00000143400
Gene: ENSMUSG00000041560

DomainStartEndE-ValueType
Pfam:Nop53 1 156 1.4e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200455
Meta Mutation Damage Score 0.4374 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
MGI Phenotype PHENOTYPE: Homozygous knockout is pre-implantation embryonic lethal. Heterozygous knockout reduces incidence of chemically induced skin papilloma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn1 A T 13: 45,567,671 H249Q probably damaging Het
Cd22 A C 7: 30,872,964 S362A possibly damaging Het
Cep120 G A 18: 53,724,536 P286S probably benign Het
Ces1g G A 8: 93,306,972 P441S possibly damaging Het
Ces2h A G 8: 105,017,840 I316V probably benign Het
Cntnap5c T A 17: 58,293,904 D747E possibly damaging Het
Cwf19l2 T C 9: 3,450,015 V572A probably benign Het
Cyb5rl C T 4: 107,073,905 A128V probably damaging Het
Dnttip1 T C 2: 164,765,161 Y241H probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Golga4 A G 9: 118,514,210 T11A possibly damaging Het
Ip6k2 C A 9: 108,806,011 T440K probably benign Het
Kif5c A G 2: 49,688,737 N126D probably benign Het
Mdn1 T A 4: 32,774,041 F5551I possibly damaging Het
Myh11 A G 16: 14,205,553 L1587P probably damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 T C 5: 27,744,137 T1045A probably benign Het
Pdzd3 C T 9: 44,248,230 probably null Het
Plg A T 17: 12,391,845 H215L probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rapgef2 T A 3: 79,069,128 Q1307L probably benign Het
Serpini2 T C 3: 75,259,563 E129G possibly damaging Het
Stx1b C T 7: 127,807,896 R209Q probably damaging Het
Tcf20 A G 15: 82,854,535 I905T possibly damaging Het
Tmem252 G A 19: 24,674,099 A11T probably benign Het
Tpst2 A G 5: 112,307,757 N54S probably benign Het
Usp31 T C 7: 121,678,330 S269G probably benign Het
Wasf1 T C 10: 40,926,620 probably null Het
Zfp429 A T 13: 67,396,130 V58D probably damaging Het
Zfp958 A G 8: 4,628,940 T322A possibly damaging Het
Other mutations in Nop53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Nop53 APN 7 15940157 missense probably damaging 1.00
IGL01558:Nop53 APN 7 15945826 unclassified probably benign
IGL02519:Nop53 APN 7 15939272 splice site probably benign
levophed UTSW 7 15945854 missense possibly damaging 0.91
R0315:Nop53 UTSW 7 15945310 missense probably damaging 1.00
R1614:Nop53 UTSW 7 15945965 missense probably benign 0.04
R2004:Nop53 UTSW 7 15938228 missense probably damaging 1.00
R4169:Nop53 UTSW 7 15942319 missense probably benign 0.01
R4760:Nop53 UTSW 7 15942887 missense probably benign 0.07
R4788:Nop53 UTSW 7 15942315 missense possibly damaging 0.82
R4830:Nop53 UTSW 7 15942204 missense probably damaging 0.97
R5734:Nop53 UTSW 7 15945962 unclassified probably null
R6136:Nop53 UTSW 7 15938389 nonsense probably null
R6946:Nop53 UTSW 7 15938358 missense probably damaging 0.99
R7384:Nop53 UTSW 7 15939495 missense probably damaging 1.00
Z1177:Nop53 UTSW 7 15941745 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GGGGAAAACTTAAACTTTGTTGGG -3'
(R):5'- AGCGACTAAGCTCTTCCTTTAAG -3'

Sequencing Primer
(F):5'- AAACTTTGTTGGGATTTTCGCAC -3'
(R):5'- CTTCCTTTAAGAAGATGGCTGC -3'
Posted On2018-07-23