Incidental Mutation 'R6688:Gm2381'
ID527859
Institutional Source Beutler Lab
Gene Symbol Gm2381
Ensembl Gene ENSMUSG00000092225
Gene Namepredicted gene 2381
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R6688 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location42816829-42867234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42820586 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 38 (A38V)
Ref Sequence ENSEMBL: ENSMUSP00000133949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174558]
Predicted Effect probably benign
Transcript: ENSMUST00000174558
AA Change: A38V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000133949
Gene: ENSMUSG00000092225
AA Change: A38V

DomainStartEndE-ValueType
Blast:KRAB 1 34 1e-15 BLAST
ZnF_C2H2 99 121 5.5e-3 SMART
ZnF_C2H2 127 149 5.9e-3 SMART
ZnF_C2H2 155 177 7.37e-4 SMART
ZnF_C2H2 183 205 2.75e-3 SMART
ZnF_C2H2 211 233 3.69e-4 SMART
ZnF_C2H2 239 261 3.34e-2 SMART
ZnF_C2H2 267 289 1.58e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn1 A T 13: 45,567,671 H249Q probably damaging Het
Cd22 A C 7: 30,872,964 S362A possibly damaging Het
Cep120 G A 18: 53,724,536 P286S probably benign Het
Ces1g G A 8: 93,306,972 P441S possibly damaging Het
Ces2h A G 8: 105,017,840 I316V probably benign Het
Cntnap5c T A 17: 58,293,904 D747E possibly damaging Het
Cwf19l2 T C 9: 3,450,015 V572A probably benign Het
Cyb5rl C T 4: 107,073,905 A128V probably damaging Het
Dnttip1 T C 2: 164,765,161 Y241H probably damaging Het
Golga4 A G 9: 118,514,210 T11A possibly damaging Het
Ip6k2 C A 9: 108,806,011 T440K probably benign Het
Kif5c A G 2: 49,688,737 N126D probably benign Het
Mdn1 T A 4: 32,774,041 F5551I possibly damaging Het
Myh11 A G 16: 14,205,553 L1587P probably damaging Het
Nop53 A G 7: 15,945,854 V67A possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 T C 5: 27,744,137 T1045A probably benign Het
Pdzd3 C T 9: 44,248,230 probably null Het
Plg A T 17: 12,391,845 H215L probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rapgef2 T A 3: 79,069,128 Q1307L probably benign Het
Serpini2 T C 3: 75,259,563 E129G possibly damaging Het
Stx1b C T 7: 127,807,896 R209Q probably damaging Het
Tcf20 A G 15: 82,854,535 I905T possibly damaging Het
Tmem252 G A 19: 24,674,099 A11T probably benign Het
Tpst2 A G 5: 112,307,757 N54S probably benign Het
Usp31 T C 7: 121,678,330 S269G probably benign Het
Wasf1 T C 10: 40,926,620 probably null Het
Zfp429 A T 13: 67,396,130 V58D probably damaging Het
Zfp958 A G 8: 4,628,940 T322A possibly damaging Het
Other mutations in Gm2381
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02309:Gm2381 APN 7 42822609 splice site probably benign
R0266:Gm2381 UTSW 7 42819948 nonsense probably null
R0617:Gm2381 UTSW 7 42819978 missense probably damaging 1.00
R0650:Gm2381 UTSW 7 42820080 missense probably damaging 0.98
R0849:Gm2381 UTSW 7 42819948 nonsense probably null
R1340:Gm2381 UTSW 7 42820404 missense possibly damaging 0.76
R1549:Gm2381 UTSW 7 42822401 missense probably benign 0.09
R1702:Gm2381 UTSW 7 42820231 missense probably benign 0.08
R1708:Gm2381 UTSW 7 42820225 missense probably benign 0.05
R1909:Gm2381 UTSW 7 42819928 missense probably damaging 1.00
R2848:Gm2381 UTSW 7 42820407 missense probably damaging 0.98
R2849:Gm2381 UTSW 7 42820407 missense probably damaging 0.98
R4437:Gm2381 UTSW 7 42819844 missense probably damaging 1.00
R5445:Gm2381 UTSW 7 42820001 missense probably damaging 0.96
R5702:Gm2381 UTSW 7 42822396 missense probably benign 0.12
R6370:Gm2381 UTSW 7 42820586 missense probably benign 0.00
R6371:Gm2381 UTSW 7 42820586 missense probably benign 0.00
R6372:Gm2381 UTSW 7 42820586 missense probably benign 0.00
R7150:Gm2381 UTSW 7 42820464 missense probably benign 0.04
R7336:Gm2381 UTSW 7 42822380 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TGTACAAAGGCTTTACCACATTGAT -3'
(R):5'- GGGATTCGAACTGAGGACCT -3'

Sequencing Primer
(F):5'- CATGTGCTCGAAGATACTTGAGC -3'
(R):5'- GAGAAGTCAATGCTCTTAACAGC -3'
Posted On2018-07-23