Incidental Mutation 'R6688:Stx1b'
ID527861
Institutional Source Beutler Lab
Gene Symbol Stx1b
Ensembl Gene ENSMUSG00000030806
Gene Namesyntaxin 1B
SynonymsStx1b2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R6688 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127803900-127824549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127807896 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 209 (R209Q)
Ref Sequence ENSEMBL: ENSMUSP00000101874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046863] [ENSMUST00000106267] [ENSMUST00000106271] [ENSMUST00000106272] [ENSMUST00000154987] [ENSMUST00000156135]
Predicted Effect probably benign
Transcript: ENSMUST00000046863
SMART Domains Protein: ENSMUSP00000036245
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:KR 11 147 3e-10 PFAM
Pfam:RmlD_sub_bind 11 198 8.1e-10 PFAM
Pfam:Polysacc_synt_2 12 140 4.6e-13 PFAM
Pfam:NmrA 12 142 1.9e-9 PFAM
Pfam:Epimerase 12 215 3.2e-25 PFAM
Pfam:GDP_Man_Dehyd 13 185 8.1e-17 PFAM
Pfam:3Beta_HSD 13 290 5.4e-99 PFAM
Pfam:NAD_binding_4 14 240 1.4e-15 PFAM
transmembrane domain 312 334 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106267
AA Change: R209Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101874
Gene: ENSMUSG00000030806
AA Change: R209Q

DomainStartEndE-ValueType
SynN 24 145 1.99e-44 SMART
t_SNARE 186 253 4.32e-24 SMART
transmembrane domain 265 287 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106271
SMART Domains Protein: ENSMUSP00000101878
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:adh_short 10 143 1.3e-13 PFAM
Pfam:RmlD_sub_bind 10 186 3.7e-10 PFAM
Pfam:KR 11 140 5.7e-10 PFAM
Pfam:Polysacc_synt_2 12 140 2.8e-13 PFAM
Pfam:NmrA 12 141 2.7e-9 PFAM
Pfam:Epimerase 12 220 2.9e-26 PFAM
Pfam:NAD_binding_10 13 186 2.3e-11 PFAM
Pfam:3Beta_HSD 13 216 1e-70 PFAM
Pfam:NAD_binding_4 14 183 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106272
SMART Domains Protein: ENSMUSP00000101879
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:adh_short 10 143 3.7e-13 PFAM
Pfam:RmlD_sub_bind 10 180 2.8e-9 PFAM
Pfam:KR 11 139 1.6e-9 PFAM
Pfam:Polysacc_synt_2 12 140 7.7e-13 PFAM
Pfam:NmrA 12 141 7.3e-9 PFAM
Pfam:Epimerase 12 215 7.1e-26 PFAM
Pfam:NAD_binding_10 13 179 1.1e-10 PFAM
Pfam:3Beta_HSD 13 188 6.1e-70 PFAM
Pfam:NAD_binding_4 14 187 1.5e-17 PFAM
Pfam:3Beta_HSD 177 261 4e-23 PFAM
transmembrane domain 281 303 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144748
Predicted Effect probably benign
Transcript: ENSMUST00000154987
Predicted Effect probably benign
Transcript: ENSMUST00000156135
AA Change: R63Q

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206297
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of proteins thought to play a role in the exocytosis of synaptic vesicles. Vesicle exocytosis releases vesicular contents and is important to various cellular functions. For instance, the secretion of transmitters from neurons plays an important role in synaptic transmission. After exocytosis, the membrane and proteins from the vesicle are retrieved from the plasma membrane through the process of endocytosis. Mutations in this gene have been identified as one cause of fever-associated epilepsy syndromes. A possible link between this gene and Parkinson's disease has also been suggested. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele that encodes an 'open' syntaxin-1B protein conformation are viable but display severe ataxia, reduced chromaffin vesicle docking, accelerated synaptic vesicle fusion, and lethal epileptic seizures after 2 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn1 A T 13: 45,567,671 H249Q probably damaging Het
Cd22 A C 7: 30,872,964 S362A possibly damaging Het
Cep120 G A 18: 53,724,536 P286S probably benign Het
Ces1g G A 8: 93,306,972 P441S possibly damaging Het
Ces2h A G 8: 105,017,840 I316V probably benign Het
Cntnap5c T A 17: 58,293,904 D747E possibly damaging Het
Cwf19l2 T C 9: 3,450,015 V572A probably benign Het
Cyb5rl C T 4: 107,073,905 A128V probably damaging Het
Dnttip1 T C 2: 164,765,161 Y241H probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Golga4 A G 9: 118,514,210 T11A possibly damaging Het
Ip6k2 C A 9: 108,806,011 T440K probably benign Het
Kif5c A G 2: 49,688,737 N126D probably benign Het
Mdn1 T A 4: 32,774,041 F5551I possibly damaging Het
Myh11 A G 16: 14,205,553 L1587P probably damaging Het
Nop53 A G 7: 15,945,854 V67A possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 T C 5: 27,744,137 T1045A probably benign Het
Pdzd3 C T 9: 44,248,230 probably null Het
Plg A T 17: 12,391,845 H215L probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rapgef2 T A 3: 79,069,128 Q1307L probably benign Het
Serpini2 T C 3: 75,259,563 E129G possibly damaging Het
Tcf20 A G 15: 82,854,535 I905T possibly damaging Het
Tmem252 G A 19: 24,674,099 A11T probably benign Het
Tpst2 A G 5: 112,307,757 N54S probably benign Het
Usp31 T C 7: 121,678,330 S269G probably benign Het
Wasf1 T C 10: 40,926,620 probably null Het
Zfp429 A T 13: 67,396,130 V58D probably damaging Het
Zfp958 A G 8: 4,628,940 T322A possibly damaging Het
Other mutations in Stx1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Stx1b APN 7 127810698 missense probably damaging 1.00
IGL02730:Stx1b APN 7 127815377 missense probably benign 0.37
IGL03394:Stx1b APN 7 127807884 missense probably damaging 1.00
R0680:Stx1b UTSW 7 127807723 missense possibly damaging 0.80
R1141:Stx1b UTSW 7 127810926 splice site probably null
R1511:Stx1b UTSW 7 127814972 missense probably damaging 0.99
R2024:Stx1b UTSW 7 127815403 missense probably benign 0.00
R2116:Stx1b UTSW 7 127810905 missense probably damaging 1.00
R4964:Stx1b UTSW 7 127807921 missense probably damaging 1.00
R4966:Stx1b UTSW 7 127807921 missense probably damaging 1.00
R5385:Stx1b UTSW 7 127815403 missense probably benign 0.00
R5386:Stx1b UTSW 7 127815403 missense probably benign 0.00
R5777:Stx1b UTSW 7 127810918 nonsense probably null
R6092:Stx1b UTSW 7 127807863 missense possibly damaging 0.94
R6184:Stx1b UTSW 7 127807905 missense possibly damaging 0.79
R6843:Stx1b UTSW 7 127814979 nonsense probably null
R7493:Stx1b UTSW 7 127807359 missense possibly damaging 0.88
R7919:Stx1b UTSW 7 127807335 missense probably benign 0.19
R8401:Stx1b UTSW 7 127807773 splice site probably benign
Predicted Primers PCR Primer
(F):5'- ACAGCTTTCTTGGTGTCAGAC -3'
(R):5'- TATCACTACACAAGGATTTGAACCC -3'

Sequencing Primer
(F):5'- TGTCAGACACGGCTCGTTC -3'
(R):5'- GATTTGAACCCAAACCCTCTGTTG -3'
Posted On2018-07-23