Mutagenetix > Incidental Mutations

Incidental Mutation 'R6688:Ces2h'

527864

Institutional Source

Beutler Lab

Gene Symbol

Ces2h

Ensembl Gene

ENSMUSG00000091813

Gene Name

carboxylesterase 2H

Synonyms

Gm5744

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R6688 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

105000853-105021178 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 105017840 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 316 (I316V)

Ref Sequence

ENSEMBL: ENSMUSP00000126773 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172032]

Predicted Effect

probably benign
Transcript: ENSMUST00000172032
AA Change: I316V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000126773
Gene: ENSMUSG00000091813
AA Change: I316V

Domain	Start	End	E-Value	Type
Pfam:COesterase	9	537	2.5e-167	PFAM
Pfam:Abhydrolase_3	142	275	4.1e-11	PFAM
Pfam:Peptidase_S9	161	326	3.3e-8	PFAM
coiled coil region	538	558	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. The protein encoded by this gene is the major intestinal enzyme and functions in intestine drug clearance. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atxn1	A	T	13: 45,567,671	H249Q	probably damaging	Het
Cd22	A	C	7: 30,872,964	S362A	possibly damaging	Het
Cep120	G	A	18: 53,724,536	P286S	probably benign	Het
Ces1g	G	A	8: 93,306,972	P441S	possibly damaging	Het
Cntnap5c	T	A	17: 58,293,904	D747E	possibly damaging	Het
Cwf19l2	T	C	9: 3,450,015	V572A	probably benign	Het
Cyb5rl	C	T	4: 107,073,905	A128V	probably damaging	Het
Dnttip1	T	C	2: 164,765,161	Y241H	probably damaging	Het
Gm2381	G	A	7: 42,820,586	A38V	probably benign	Het
Golga4	A	G	9: 118,514,210	T11A	possibly damaging	Het
Ip6k2	C	A	9: 108,806,011	T440K	probably benign	Het
Kif5c	A	G	2: 49,688,737	N126D	probably benign	Het
Mdn1	T	A	4: 32,774,041	F5551I	possibly damaging	Het
Myh11	A	G	16: 14,205,553	L1587P	probably damaging	Het
Nop53	A	G	7: 15,945,854	V67A	possibly damaging	Het
Olfr107	G	A	17: 37,405,905	R119H	probably benign	Het
Paxip1	T	C	5: 27,744,137	T1045A	probably benign	Het
Pdzd3	C	T	9: 44,248,230		probably null	Het
Plg	A	T	17: 12,391,845	H215L	probably damaging	Het
Psmb5	C	A	14: 54,616,673	R116L	probably damaging	Het
Rapgef2	T	A	3: 79,069,128	Q1307L	probably benign	Het
Serpini2	T	C	3: 75,259,563	E129G	possibly damaging	Het
Stx1b	C	T	7: 127,807,896	R209Q	probably damaging	Het
Tcf20	A	G	15: 82,854,535	I905T	possibly damaging	Het
Tmem252	G	A	19: 24,674,099	A11T	probably benign	Het
Tpst2	A	G	5: 112,307,757	N54S	probably benign	Het
Usp31	T	C	7: 121,678,330	S269G	probably benign	Het
Wasf1	T	C	10: 40,926,620		probably null	Het
Zfp429	A	T	13: 67,396,130	V58D	probably damaging	Het
Zfp958	A	G	8: 4,628,940	T322A	possibly damaging	Het

Other mutations in Ces2h

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01530:Ces2h	APN	8	105014484	missense	probably benign	0.01
IGL02268:Ces2h	APN	8	105019940	missense	probably benign	0.00
IGL03133:Ces2h	APN	8	105016779	missense	probably damaging	1.00
R0138:Ces2h	UTSW	8	105018061	missense	probably benign	0.01
R0294:Ces2h	UTSW	8	105016604	missense	probably benign	0.01
R0482:Ces2h	UTSW	8	105020271	missense	possibly damaging	0.48
R0899:Ces2h	UTSW	8	105014550	missense	probably damaging	1.00
R1232:Ces2h	UTSW	8	105014655	missense	probably benign	0.38
R1535:Ces2h	UTSW	8	105014486	missense	probably benign	0.06
R1738:Ces2h	UTSW	8	105019065	critical splice donor site	probably null
R1748:Ces2h	UTSW	8	105017841	missense	probably benign	0.00
R1759:Ces2h	UTSW	8	105016611	missense	probably damaging	1.00
R1778:Ces2h	UTSW	8	105014607	missense	possibly damaging	0.93
R1833:Ces2h	UTSW	8	105020373	missense	possibly damaging	0.93
R1999:Ces2h	UTSW	8	105020345	missense	probably benign	0.03
R2018:Ces2h	UTSW	8	105018398	missense	probably damaging	1.00
R2076:Ces2h	UTSW	8	105019028	missense	probably benign
R2261:Ces2h	UTSW	8	105016559	missense	probably damaging	0.99
R2262:Ces2h	UTSW	8	105016559	missense	probably damaging	0.99
R2356:Ces2h	UTSW	8	105015938	missense	probably damaging	0.98
R4453:Ces2h	UTSW	8	105014656	critical splice donor site	probably null
R4656:Ces2h	UTSW	8	105014639	missense	possibly damaging	0.80
R4732:Ces2h	UTSW	8	105014604	missense	probably damaging	0.97
R4733:Ces2h	UTSW	8	105014604	missense	probably damaging	0.97
R5219:Ces2h	UTSW	8	105016646	missense	probably damaging	1.00
R5400:Ces2h	UTSW	8	105018425	missense	probably benign	0.01
R5696:Ces2h	UTSW	8	105018979	missense	possibly damaging	0.69
R5894:Ces2h	UTSW	8	105019026	missense	probably benign	0.14
R6711:Ces2h	UTSW	8	105018083	missense	probably benign	0.22
R6868:Ces2h	UTSW	8	105018423	missense	probably benign	0.02
R7233:Ces2h	UTSW	8	105017456	missense	probably damaging	0.99
R7516:Ces2h	UTSW	8	105016826	missense	probably damaging	1.00
R7710:Ces2h	UTSW	8	105000865	nonsense	probably null
R7735:Ces2h	UTSW	8	105014495	missense	probably benign	0.01
R7803:Ces2h	UTSW	8	105018400	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTCTGAAGAGCAGGACATGG -3'
(R):5'- AATCATGCTCATGCTCTAAGTGG -3'

Sequencing Primer
(F):5'- GGAAACCATCTGTAGGACCTCATAG -3'
(R):5'- CATGCTCATGCTCTAAGTGGTAAGAG -3'

Posted On

2018-07-23