Incidental Mutation 'R6688:Ces2h'
ID527864
Institutional Source Beutler Lab
Gene Symbol Ces2h
Ensembl Gene ENSMUSG00000091813
Gene Namecarboxylesterase 2H
SynonymsGm5744
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R6688 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location105000853-105021178 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105017840 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 316 (I316V)
Ref Sequence ENSEMBL: ENSMUSP00000126773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172032]
Predicted Effect probably benign
Transcript: ENSMUST00000172032
AA Change: I316V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126773
Gene: ENSMUSG00000091813
AA Change: I316V

DomainStartEndE-ValueType
Pfam:COesterase 9 537 2.5e-167 PFAM
Pfam:Abhydrolase_3 142 275 4.1e-11 PFAM
Pfam:Peptidase_S9 161 326 3.3e-8 PFAM
coiled coil region 538 558 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. The protein encoded by this gene is the major intestinal enzyme and functions in intestine drug clearance. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn1 A T 13: 45,567,671 H249Q probably damaging Het
Cd22 A C 7: 30,872,964 S362A possibly damaging Het
Cep120 G A 18: 53,724,536 P286S probably benign Het
Ces1g G A 8: 93,306,972 P441S possibly damaging Het
Cntnap5c T A 17: 58,293,904 D747E possibly damaging Het
Cwf19l2 T C 9: 3,450,015 V572A probably benign Het
Cyb5rl C T 4: 107,073,905 A128V probably damaging Het
Dnttip1 T C 2: 164,765,161 Y241H probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Golga4 A G 9: 118,514,210 T11A possibly damaging Het
Ip6k2 C A 9: 108,806,011 T440K probably benign Het
Kif5c A G 2: 49,688,737 N126D probably benign Het
Mdn1 T A 4: 32,774,041 F5551I possibly damaging Het
Myh11 A G 16: 14,205,553 L1587P probably damaging Het
Nop53 A G 7: 15,945,854 V67A possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 T C 5: 27,744,137 T1045A probably benign Het
Pdzd3 C T 9: 44,248,230 probably null Het
Plg A T 17: 12,391,845 H215L probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rapgef2 T A 3: 79,069,128 Q1307L probably benign Het
Serpini2 T C 3: 75,259,563 E129G possibly damaging Het
Stx1b C T 7: 127,807,896 R209Q probably damaging Het
Tcf20 A G 15: 82,854,535 I905T possibly damaging Het
Tmem252 G A 19: 24,674,099 A11T probably benign Het
Tpst2 A G 5: 112,307,757 N54S probably benign Het
Usp31 T C 7: 121,678,330 S269G probably benign Het
Wasf1 T C 10: 40,926,620 probably null Het
Zfp429 A T 13: 67,396,130 V58D probably damaging Het
Zfp958 A G 8: 4,628,940 T322A possibly damaging Het
Other mutations in Ces2h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Ces2h APN 8 105014484 missense probably benign 0.01
IGL02268:Ces2h APN 8 105019940 missense probably benign 0.00
IGL03133:Ces2h APN 8 105016779 missense probably damaging 1.00
R0138:Ces2h UTSW 8 105018061 missense probably benign 0.01
R0294:Ces2h UTSW 8 105016604 missense probably benign 0.01
R0482:Ces2h UTSW 8 105020271 missense possibly damaging 0.48
R0899:Ces2h UTSW 8 105014550 missense probably damaging 1.00
R1232:Ces2h UTSW 8 105014655 missense probably benign 0.38
R1535:Ces2h UTSW 8 105014486 missense probably benign 0.06
R1738:Ces2h UTSW 8 105019065 critical splice donor site probably null
R1748:Ces2h UTSW 8 105017841 missense probably benign 0.00
R1759:Ces2h UTSW 8 105016611 missense probably damaging 1.00
R1778:Ces2h UTSW 8 105014607 missense possibly damaging 0.93
R1833:Ces2h UTSW 8 105020373 missense possibly damaging 0.93
R1999:Ces2h UTSW 8 105020345 missense probably benign 0.03
R2018:Ces2h UTSW 8 105018398 missense probably damaging 1.00
R2076:Ces2h UTSW 8 105019028 missense probably benign
R2261:Ces2h UTSW 8 105016559 missense probably damaging 0.99
R2262:Ces2h UTSW 8 105016559 missense probably damaging 0.99
R2356:Ces2h UTSW 8 105015938 missense probably damaging 0.98
R4453:Ces2h UTSW 8 105014656 critical splice donor site probably null
R4656:Ces2h UTSW 8 105014639 missense possibly damaging 0.80
R4732:Ces2h UTSW 8 105014604 missense probably damaging 0.97
R4733:Ces2h UTSW 8 105014604 missense probably damaging 0.97
R5219:Ces2h UTSW 8 105016646 missense probably damaging 1.00
R5400:Ces2h UTSW 8 105018425 missense probably benign 0.01
R5696:Ces2h UTSW 8 105018979 missense possibly damaging 0.69
R5894:Ces2h UTSW 8 105019026 missense probably benign 0.14
R6711:Ces2h UTSW 8 105018083 missense probably benign 0.22
R6868:Ces2h UTSW 8 105018423 missense probably benign 0.02
R7233:Ces2h UTSW 8 105017456 missense probably damaging 0.99
R7516:Ces2h UTSW 8 105016826 missense probably damaging 1.00
R7710:Ces2h UTSW 8 105000865 nonsense probably null
R7735:Ces2h UTSW 8 105014495 missense probably benign 0.01
R7803:Ces2h UTSW 8 105018400 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCTGAAGAGCAGGACATGG -3'
(R):5'- AATCATGCTCATGCTCTAAGTGG -3'

Sequencing Primer
(F):5'- GGAAACCATCTGTAGGACCTCATAG -3'
(R):5'- CATGCTCATGCTCTAAGTGGTAAGAG -3'
Posted On2018-07-23