Mutagenetix > Incidental Mutations

Incidental Mutation 'R6688:Ip6k2'

527867

Institutional Source

Beutler Lab

Gene Symbol

Ip6k2

Ensembl Gene

ENSMUSG00000032599

Gene Name

inositol hexaphosphate kinase 2

Synonyms

Ihpk2, 1500005N04Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6688 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

108783796-108806337 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 108806011 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 440 (T440K)

Ref Sequence

ENSEMBL: ENSMUSP00000082091 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035218] [ENSMUST00000085018] [ENSMUST00000193560] [ENSMUST00000194819] [ENSMUST00000195323]

Predicted Effect

probably benign
Transcript: ENSMUST00000035218

SMART Domains

Protein: ENSMUSP00000035218
Gene: ENSMUSG00000032598

Domain	Start	End	E-Value	Type
SH3	1	57	2.21e-9	SMART
low complexity region	162	179	N/A	INTRINSIC
low complexity region	200	215	N/A	INTRINSIC
low complexity region	230	240	N/A	INTRINSIC
low complexity region	249	271	N/A	INTRINSIC
low complexity region	288	298	N/A	INTRINSIC
Pfam:DUF2013	539	675	5e-36	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000085018
AA Change: T440K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000082091
Gene: ENSMUSG00000032599
AA Change: T440K

Domain	Start	End	E-Value	Type
Pfam:IPK	225	440	2.7e-64	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000193560
AA Change: T394K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000141605
Gene: ENSMUSG00000032599
AA Change: T394K

Domain	Start	End	E-Value	Type
Pfam:IPK	179	394	1.6e-61	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000194819

SMART Domains

Protein: ENSMUSP00000141702
Gene: ENSMUSG00000032598

Domain	Start	End	E-Value	Type
SH3	1	52	3.3e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000195323

SMART Domains

Protein: ENSMUSP00000141728
Gene: ENSMUSG00000032598

Domain	Start	End	E-Value	Type
SH3	1	57	1.4e-11	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the inositol phosphokinase (IPK) family. This protein is likely responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4 and affect the growth suppressive and apoptotic activities of interferon-beta in some ovarian cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele are resistant to radiation-induced mortality and show increased double-strand DNA break repair and incidence of induced aerodigestive tract carcinomas. Homozygotes for another null allele show increased B cell viability after radiation or neocarzinostatin treatment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atxn1	A	T	13: 45,567,671	H249Q	probably damaging	Het
Cd22	A	C	7: 30,872,964	S362A	possibly damaging	Het
Cep120	G	A	18: 53,724,536	P286S	probably benign	Het
Ces1g	G	A	8: 93,306,972	P441S	possibly damaging	Het
Ces2h	A	G	8: 105,017,840	I316V	probably benign	Het
Cntnap5c	T	A	17: 58,293,904	D747E	possibly damaging	Het
Cwf19l2	T	C	9: 3,450,015	V572A	probably benign	Het
Cyb5rl	C	T	4: 107,073,905	A128V	probably damaging	Het
Dnttip1	T	C	2: 164,765,161	Y241H	probably damaging	Het
Gm2381	G	A	7: 42,820,586	A38V	probably benign	Het
Golga4	A	G	9: 118,514,210	T11A	possibly damaging	Het
Kif5c	A	G	2: 49,688,737	N126D	probably benign	Het
Mdn1	T	A	4: 32,774,041	F5551I	possibly damaging	Het
Myh11	A	G	16: 14,205,553	L1587P	probably damaging	Het
Nop53	A	G	7: 15,945,854	V67A	possibly damaging	Het
Olfr107	G	A	17: 37,405,905	R119H	probably benign	Het
Paxip1	T	C	5: 27,744,137	T1045A	probably benign	Het
Pdzd3	C	T	9: 44,248,230		probably null	Het
Plg	A	T	17: 12,391,845	H215L	probably damaging	Het
Psmb5	C	A	14: 54,616,673	R116L	probably damaging	Het
Rapgef2	T	A	3: 79,069,128	Q1307L	probably benign	Het
Serpini2	T	C	3: 75,259,563	E129G	possibly damaging	Het
Stx1b	C	T	7: 127,807,896	R209Q	probably damaging	Het
Tcf20	A	G	15: 82,854,535	I905T	possibly damaging	Het
Tmem252	G	A	19: 24,674,099	A11T	probably benign	Het
Tpst2	A	G	5: 112,307,757	N54S	probably benign	Het
Usp31	T	C	7: 121,678,330	S269G	probably benign	Het
Wasf1	T	C	10: 40,926,620		probably null	Het
Zfp429	A	T	13: 67,396,130	V58D	probably damaging	Het
Zfp958	A	G	8: 4,628,940	T322A	possibly damaging	Het

Other mutations in Ip6k2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01100:Ip6k2	APN	9	108805744	missense	probably damaging	1.00
IGL01585:Ip6k2	APN	9	108796313	missense	probably damaging	1.00
IGL02377:Ip6k2	APN	9	108804599	missense	probably damaging	1.00
IGL02831:Ip6k2	APN	9	108804534	unclassified	probably benign
banting	UTSW	9	108805648	missense	probably benign	0.07
R0310:Ip6k2	UTSW	9	108799233	splice site	probably benign
R0541:Ip6k2	UTSW	9	108804627	missense	probably damaging	1.00
R2378:Ip6k2	UTSW	9	108796301	splice site	probably null
R4119:Ip6k2	UTSW	9	108805648	missense	probably benign	0.07
R4120:Ip6k2	UTSW	9	108805648	missense	probably benign	0.07
R4165:Ip6k2	UTSW	9	108805648	missense	probably benign	0.07
R4231:Ip6k2	UTSW	9	108805648	missense	probably benign	0.07
R4232:Ip6k2	UTSW	9	108805648	missense	probably benign	0.07
R4235:Ip6k2	UTSW	9	108805648	missense	probably benign	0.07
R4236:Ip6k2	UTSW	9	108805648	missense	probably benign	0.07
R4327:Ip6k2	UTSW	9	108805648	missense	probably benign	0.07
R4328:Ip6k2	UTSW	9	108805648	missense	probably benign	0.07
R5019:Ip6k2	UTSW	9	108797746	intron	probably benign
R5466:Ip6k2	UTSW	9	108798462	missense	probably damaging	1.00
R6017:Ip6k2	UTSW	9	108797267	missense	probably benign	0.01
R6971:Ip6k2	UTSW	9	108797311	intron	probably benign
R7150:Ip6k2	UTSW	9	108796731	missense	unknown
R8007:Ip6k2	UTSW	9	108805756	missense	probably benign	0.15

Predicted Primers

PCR Primer
(F):5'- AAGAGTCGGCTGATGAGTCTG -3'
(R):5'- GAGGTATCTGCATCATCAAATGTGG -3'

Sequencing Primer
(F):5'- AGTCTGCCGGTGCCTATG -3'
(R):5'- CTGCATCATCAAATGTGGAATGTTG -3'

Posted On

2018-07-23