Incidental Mutation 'R6688:Ip6k2'
ID527867
Institutional Source Beutler Lab
Gene Symbol Ip6k2
Ensembl Gene ENSMUSG00000032599
Gene Nameinositol hexaphosphate kinase 2
SynonymsIhpk2, 1500005N04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6688 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108783796-108806337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 108806011 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 440 (T440K)
Ref Sequence ENSEMBL: ENSMUSP00000082091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035218] [ENSMUST00000085018] [ENSMUST00000193560] [ENSMUST00000194819] [ENSMUST00000195323]
Predicted Effect probably benign
Transcript: ENSMUST00000035218
SMART Domains Protein: ENSMUSP00000035218
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 57 2.21e-9 SMART
low complexity region 162 179 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 230 240 N/A INTRINSIC
low complexity region 249 271 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
Pfam:DUF2013 539 675 5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085018
AA Change: T440K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000082091
Gene: ENSMUSG00000032599
AA Change: T440K

DomainStartEndE-ValueType
Pfam:IPK 225 440 2.7e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193560
AA Change: T394K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141605
Gene: ENSMUSG00000032599
AA Change: T394K

DomainStartEndE-ValueType
Pfam:IPK 179 394 1.6e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194819
SMART Domains Protein: ENSMUSP00000141702
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 52 3.3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195323
SMART Domains Protein: ENSMUSP00000141728
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 57 1.4e-11 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the inositol phosphokinase (IPK) family. This protein is likely responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4 and affect the growth suppressive and apoptotic activities of interferon-beta in some ovarian cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele are resistant to radiation-induced mortality and show increased double-strand DNA break repair and incidence of induced aerodigestive tract carcinomas. Homozygotes for another null allele show increased B cell viability after radiation or neocarzinostatin treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn1 A T 13: 45,567,671 H249Q probably damaging Het
Cd22 A C 7: 30,872,964 S362A possibly damaging Het
Cep120 G A 18: 53,724,536 P286S probably benign Het
Ces1g G A 8: 93,306,972 P441S possibly damaging Het
Ces2h A G 8: 105,017,840 I316V probably benign Het
Cntnap5c T A 17: 58,293,904 D747E possibly damaging Het
Cwf19l2 T C 9: 3,450,015 V572A probably benign Het
Cyb5rl C T 4: 107,073,905 A128V probably damaging Het
Dnttip1 T C 2: 164,765,161 Y241H probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Golga4 A G 9: 118,514,210 T11A possibly damaging Het
Kif5c A G 2: 49,688,737 N126D probably benign Het
Mdn1 T A 4: 32,774,041 F5551I possibly damaging Het
Myh11 A G 16: 14,205,553 L1587P probably damaging Het
Nop53 A G 7: 15,945,854 V67A possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 T C 5: 27,744,137 T1045A probably benign Het
Pdzd3 C T 9: 44,248,230 probably null Het
Plg A T 17: 12,391,845 H215L probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rapgef2 T A 3: 79,069,128 Q1307L probably benign Het
Serpini2 T C 3: 75,259,563 E129G possibly damaging Het
Stx1b C T 7: 127,807,896 R209Q probably damaging Het
Tcf20 A G 15: 82,854,535 I905T possibly damaging Het
Tmem252 G A 19: 24,674,099 A11T probably benign Het
Tpst2 A G 5: 112,307,757 N54S probably benign Het
Usp31 T C 7: 121,678,330 S269G probably benign Het
Wasf1 T C 10: 40,926,620 probably null Het
Zfp429 A T 13: 67,396,130 V58D probably damaging Het
Zfp958 A G 8: 4,628,940 T322A possibly damaging Het
Other mutations in Ip6k2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Ip6k2 APN 9 108805744 missense probably damaging 1.00
IGL01585:Ip6k2 APN 9 108796313 missense probably damaging 1.00
IGL02377:Ip6k2 APN 9 108804599 missense probably damaging 1.00
IGL02831:Ip6k2 APN 9 108804534 unclassified probably benign
banting UTSW 9 108805648 missense probably benign 0.07
R0310:Ip6k2 UTSW 9 108799233 splice site probably benign
R0541:Ip6k2 UTSW 9 108804627 missense probably damaging 1.00
R2378:Ip6k2 UTSW 9 108796301 splice site probably null
R4119:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4120:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4165:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4231:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4232:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4235:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4236:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4327:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4328:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R5019:Ip6k2 UTSW 9 108797746 intron probably benign
R5466:Ip6k2 UTSW 9 108798462 missense probably damaging 1.00
R6017:Ip6k2 UTSW 9 108797267 missense probably benign 0.01
R6971:Ip6k2 UTSW 9 108797311 intron probably benign
R7150:Ip6k2 UTSW 9 108796731 missense unknown
R8007:Ip6k2 UTSW 9 108805756 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- AAGAGTCGGCTGATGAGTCTG -3'
(R):5'- GAGGTATCTGCATCATCAAATGTGG -3'

Sequencing Primer
(F):5'- AGTCTGCCGGTGCCTATG -3'
(R):5'- CTGCATCATCAAATGTGGAATGTTG -3'
Posted On2018-07-23