Incidental Mutation 'R6688:Wasf1'
ID527869
Institutional Source Beutler Lab
Gene Symbol Wasf1
Ensembl Gene ENSMUSG00000019831
Gene NameWAS protein family, member 1
SynonymsWAVE-1, Scar, WAVE
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.522) question?
Stock #R6688 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location40883475-40938570 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 40926620 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019975] [ENSMUST00000105509]
Predicted Effect probably null
Transcript: ENSMUST00000019975
SMART Domains Protein: ENSMUSP00000019975
Gene: ENSMUSG00000019831

DomainStartEndE-ValueType
PDB:4N78|D 1 320 N/A PDB
low complexity region 321 401 N/A INTRINSIC
low complexity region 423 435 N/A INTRINSIC
low complexity region 462 482 N/A INTRINSIC
WH2 497 514 4.32e-5 SMART
low complexity region 544 556 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105509
SMART Domains Protein: ENSMUSP00000101148
Gene: ENSMUSG00000019831

DomainStartEndE-ValueType
PDB:4N78|D 1 320 N/A PDB
low complexity region 321 401 N/A INTRINSIC
low complexity region 423 435 N/A INTRINSIC
low complexity region 462 482 N/A INTRINSIC
WH2 497 514 4.32e-5 SMART
low complexity region 544 556 N/A INTRINSIC
Meta Mutation Damage Score 0.9485 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, a member of the Wiskott-Aldrich syndrome protein (WASP)-family, plays a critical role downstream of Rac, a Rho-family small GTPase, in regulating the actin cytoskeleton required for membrane ruffling. It has been shown to associate with an actin nucleation core Arp2/3 complex while enhancing actin polymerization in vitro. Wiskott-Aldrich syndrome is a disease of the immune system, likely due to defects in regulation of actin cytoskeleton. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutation of this gene has been associated with both morphological and functional defects of the central nervous system. Targeted mutagenesis has resulted in mice that display sensorimotor and cognitive defects similar to those exhibited by patients with 3p-syndrome mental retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn1 A T 13: 45,567,671 H249Q probably damaging Het
Cd22 A C 7: 30,872,964 S362A possibly damaging Het
Cep120 G A 18: 53,724,536 P286S probably benign Het
Ces1g G A 8: 93,306,972 P441S possibly damaging Het
Ces2h A G 8: 105,017,840 I316V probably benign Het
Cntnap5c T A 17: 58,293,904 D747E possibly damaging Het
Cwf19l2 T C 9: 3,450,015 V572A probably benign Het
Cyb5rl C T 4: 107,073,905 A128V probably damaging Het
Dnttip1 T C 2: 164,765,161 Y241H probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Golga4 A G 9: 118,514,210 T11A possibly damaging Het
Ip6k2 C A 9: 108,806,011 T440K probably benign Het
Kif5c A G 2: 49,688,737 N126D probably benign Het
Mdn1 T A 4: 32,774,041 F5551I possibly damaging Het
Myh11 A G 16: 14,205,553 L1587P probably damaging Het
Nop53 A G 7: 15,945,854 V67A possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 T C 5: 27,744,137 T1045A probably benign Het
Pdzd3 C T 9: 44,248,230 probably null Het
Plg A T 17: 12,391,845 H215L probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rapgef2 T A 3: 79,069,128 Q1307L probably benign Het
Serpini2 T C 3: 75,259,563 E129G possibly damaging Het
Stx1b C T 7: 127,807,896 R209Q probably damaging Het
Tcf20 A G 15: 82,854,535 I905T possibly damaging Het
Tmem252 G A 19: 24,674,099 A11T probably benign Het
Tpst2 A G 5: 112,307,757 N54S probably benign Het
Usp31 T C 7: 121,678,330 S269G probably benign Het
Zfp429 A T 13: 67,396,130 V58D probably damaging Het
Zfp958 A G 8: 4,628,940 T322A possibly damaging Het
Other mutations in Wasf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Wasf1 APN 10 40920297 missense probably damaging 1.00
IGL01978:Wasf1 APN 10 40936201 missense unknown
IGL02265:Wasf1 APN 10 40936441 missense unknown
IGL02565:Wasf1 APN 10 40936132 missense possibly damaging 0.70
IGL02741:Wasf1 APN 10 40930709 missense probably damaging 1.00
IGL03037:Wasf1 APN 10 40930658 missense probably benign 0.42
potatoes UTSW 10 40926620 critical splice donor site probably null
K3955:Wasf1 UTSW 10 40936195 missense unknown
R0652:Wasf1 UTSW 10 40931906 splice site probably null
R1276:Wasf1 UTSW 10 40936526 missense unknown
R1774:Wasf1 UTSW 10 40934479 missense possibly damaging 0.50
R1813:Wasf1 UTSW 10 40926589 missense probably damaging 1.00
R3607:Wasf1 UTSW 10 40936384 missense unknown
R4418:Wasf1 UTSW 10 40936582 missense unknown
R4952:Wasf1 UTSW 10 40936190 missense unknown
R4997:Wasf1 UTSW 10 40934604 missense probably damaging 0.96
R5178:Wasf1 UTSW 10 40937676 missense unknown
R5718:Wasf1 UTSW 10 40926574 missense probably damaging 1.00
R5789:Wasf1 UTSW 10 40926574 missense probably damaging 1.00
R5791:Wasf1 UTSW 10 40926574 missense probably damaging 1.00
R5839:Wasf1 UTSW 10 40936319 missense unknown
R6247:Wasf1 UTSW 10 40937745 missense unknown
R6889:Wasf1 UTSW 10 40920369 missense probably damaging 1.00
R6977:Wasf1 UTSW 10 40926585 missense probably damaging 0.97
R7023:Wasf1 UTSW 10 40936475 missense unknown
R7136:Wasf1 UTSW 10 40926591 missense possibly damaging 0.91
R7224:Wasf1 UTSW 10 40926550 missense probably benign 0.17
X0025:Wasf1 UTSW 10 40936697 missense unknown
X0067:Wasf1 UTSW 10 40937657 missense unknown
Predicted Primers PCR Primer
(F):5'- GCAGGTACATTCATGGCGTG -3'
(R):5'- AGCAATGGTTCAGCAAAACTAC -3'

Sequencing Primer
(F):5'- CAGGTACATTCATGGCGTGTTTCG -3'
(R):5'- GGTCGGGGTAGACTGTATAT -3'
Posted On2018-07-23