Incidental Mutation 'R6688:Plg'
ID527875
Institutional Source Beutler Lab
Gene Symbol Plg
Ensembl Gene ENSMUSG00000059481
Gene Nameplasminogen
SynonymsPg
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R6688 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location12378609-12419384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12391845 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 215 (H215L)
Ref Sequence ENSEMBL: ENSMUSP00000014578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014578]
Predicted Effect probably damaging
Transcript: ENSMUST00000014578
AA Change: H215L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014578
Gene: ENSMUSG00000059481
AA Change: H215L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PAN_AP 20 97 8.67e-14 SMART
KR 101 183 1.31e-41 SMART
KR 184 264 5.4e-43 SMART
KR 273 354 3.45e-50 SMART
KR 375 456 3.9e-49 SMART
KR 479 562 5.53e-40 SMART
Tryp_SPc 581 805 4.11e-94 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted blood zymogen that is activated by proteolysis and converted to plasmin and angiostatin. Plasmin dissolves fibrin in blood clots and is an important protease in many other cellular processes while angiostatin inhibits angiogenesis. Defects in this gene are likely a cause of thrombophilia and ligneous conjunctivitis. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous null mutants exhibit retarded growth, variable rectal prolapse, impaired fertility and lactation in females, early mortality, and widespread fibrin deposition and thrombotic lesions in liver, lung, stomach and other tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn1 A T 13: 45,567,671 H249Q probably damaging Het
Cd22 A C 7: 30,872,964 S362A possibly damaging Het
Cep120 G A 18: 53,724,536 P286S probably benign Het
Ces1g G A 8: 93,306,972 P441S possibly damaging Het
Ces2h A G 8: 105,017,840 I316V probably benign Het
Cntnap5c T A 17: 58,293,904 D747E possibly damaging Het
Cwf19l2 T C 9: 3,450,015 V572A probably benign Het
Cyb5rl C T 4: 107,073,905 A128V probably damaging Het
Dnttip1 T C 2: 164,765,161 Y241H probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Golga4 A G 9: 118,514,210 T11A possibly damaging Het
Ip6k2 C A 9: 108,806,011 T440K probably benign Het
Kif5c A G 2: 49,688,737 N126D probably benign Het
Mdn1 T A 4: 32,774,041 F5551I possibly damaging Het
Myh11 A G 16: 14,205,553 L1587P probably damaging Het
Nop53 A G 7: 15,945,854 V67A possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 T C 5: 27,744,137 T1045A probably benign Het
Pdzd3 C T 9: 44,248,230 probably null Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rapgef2 T A 3: 79,069,128 Q1307L probably benign Het
Serpini2 T C 3: 75,259,563 E129G possibly damaging Het
Stx1b C T 7: 127,807,896 R209Q probably damaging Het
Tcf20 A G 15: 82,854,535 I905T possibly damaging Het
Tmem252 G A 19: 24,674,099 A11T probably benign Het
Tpst2 A G 5: 112,307,757 N54S probably benign Het
Usp31 T C 7: 121,678,330 S269G probably benign Het
Wasf1 T C 10: 40,926,620 probably null Het
Zfp429 A T 13: 67,396,130 V58D probably damaging Het
Zfp958 A G 8: 4,628,940 T322A possibly damaging Het
Other mutations in Plg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Plg APN 17 12411493 missense probably damaging 1.00
IGL01128:Plg APN 17 12396699 splice site probably benign
IGL01522:Plg APN 17 12404069 missense probably damaging 1.00
IGL01981:Plg APN 17 12403047 splice site probably benign
IGL03338:Plg APN 17 12419072 missense probably damaging 1.00
R0391:Plg UTSW 17 12419081 missense probably damaging 1.00
R0531:Plg UTSW 17 12411447 splice site probably benign
R0646:Plg UTSW 17 12418736 missense probably damaging 1.00
R0759:Plg UTSW 17 12410951 missense probably damaging 1.00
R1013:Plg UTSW 17 12378721 splice site probably benign
R2116:Plg UTSW 17 12384477 missense probably damaging 0.99
R2442:Plg UTSW 17 12410960 missense probably benign 0.15
R2512:Plg UTSW 17 12403229 missense probably benign
R2879:Plg UTSW 17 12404100 missense possibly damaging 0.92
R3107:Plg UTSW 17 12384429 missense probably benign 0.00
R3405:Plg UTSW 17 12403209 missense possibly damaging 0.65
R4409:Plg UTSW 17 12390263 missense probably damaging 1.00
R4861:Plg UTSW 17 12395735 missense probably benign 0.00
R4861:Plg UTSW 17 12395735 missense probably benign 0.00
R4977:Plg UTSW 17 12403089 missense probably damaging 1.00
R4990:Plg UTSW 17 12411510 missense probably benign
R5319:Plg UTSW 17 12403227 missense possibly damaging 0.49
R5443:Plg UTSW 17 12382183 missense probably benign 0.03
R5635:Plg UTSW 17 12395754 missense probably damaging 1.00
R5981:Plg UTSW 17 12378718 critical splice donor site probably null
R6166:Plg UTSW 17 12398114 missense probably damaging 0.99
R6726:Plg UTSW 17 12378708 missense probably damaging 1.00
R6995:Plg UTSW 17 12419051 missense probably benign 0.00
R7028:Plg UTSW 17 12391836 missense probably damaging 1.00
R7168:Plg UTSW 17 12388559 missense probably damaging 1.00
R7356:Plg UTSW 17 12410911 missense probably damaging 1.00
Z1176:Plg UTSW 17 12414185 missense probably benign 0.02
Z1177:Plg UTSW 17 12403233 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GACTCCGGTTTATGTTCCACTG -3'
(R):5'- AGGCTTGGATGCTGCCTTTC -3'

Sequencing Primer
(F):5'- CCACTGTGTTTCAATGTCGG -3'
(R):5'- CCTCTGGACCATGTGATGAGTAAC -3'
Posted On2018-07-23