Incidental Mutation 'R6688:Olfr107'
ID527876
Institutional Source Beutler Lab
Gene Symbol Olfr107
Ensembl Gene ENSMUSG00000063188
Gene Nameolfactory receptor 107
SynonymsMOR156-3, GA_x6K02T2PSCP-1867165-1868094
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6688 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location37399226-37407477 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37405905 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 119 (R119H)
Ref Sequence ENSEMBL: ENSMUSP00000148879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077008] [ENSMUST00000215894] [ENSMUST00000215947] [ENSMUST00000215974] [ENSMUST00000216844]
Predicted Effect probably benign
Transcript: ENSMUST00000077008
AA Change: R119H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000076267
Gene: ENSMUSG00000063188
AA Change: R119H

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.3e-54 PFAM
Pfam:7TM_GPCR_Srsx 32 302 1.3e-5 PFAM
Pfam:7tm_1 38 287 3.7e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174238
Predicted Effect probably benign
Transcript: ENSMUST00000215894
AA Change: R119H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000215947
AA Change: R119H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000215974
AA Change: R119H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000216844
AA Change: R119H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn1 A T 13: 45,567,671 H249Q probably damaging Het
Cd22 A C 7: 30,872,964 S362A possibly damaging Het
Cep120 G A 18: 53,724,536 P286S probably benign Het
Ces1g G A 8: 93,306,972 P441S possibly damaging Het
Ces2h A G 8: 105,017,840 I316V probably benign Het
Cntnap5c T A 17: 58,293,904 D747E possibly damaging Het
Cwf19l2 T C 9: 3,450,015 V572A probably benign Het
Cyb5rl C T 4: 107,073,905 A128V probably damaging Het
Dnttip1 T C 2: 164,765,161 Y241H probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Golga4 A G 9: 118,514,210 T11A possibly damaging Het
Ip6k2 C A 9: 108,806,011 T440K probably benign Het
Kif5c A G 2: 49,688,737 N126D probably benign Het
Mdn1 T A 4: 32,774,041 F5551I possibly damaging Het
Myh11 A G 16: 14,205,553 L1587P probably damaging Het
Nop53 A G 7: 15,945,854 V67A possibly damaging Het
Paxip1 T C 5: 27,744,137 T1045A probably benign Het
Pdzd3 C T 9: 44,248,230 probably null Het
Plg A T 17: 12,391,845 H215L probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rapgef2 T A 3: 79,069,128 Q1307L probably benign Het
Serpini2 T C 3: 75,259,563 E129G possibly damaging Het
Stx1b C T 7: 127,807,896 R209Q probably damaging Het
Tcf20 A G 15: 82,854,535 I905T possibly damaging Het
Tmem252 G A 19: 24,674,099 A11T probably benign Het
Tpst2 A G 5: 112,307,757 N54S probably benign Het
Usp31 T C 7: 121,678,330 S269G probably benign Het
Wasf1 T C 10: 40,926,620 probably null Het
Zfp429 A T 13: 67,396,130 V58D probably damaging Het
Zfp958 A G 8: 4,628,940 T322A possibly damaging Het
Other mutations in Olfr107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Olfr107 APN 17 37406140 missense probably benign 0.00
IGL01614:Olfr107 APN 17 37405638 missense probably benign 0.00
IGL02390:Olfr107 APN 17 37406095 missense probably benign 0.04
R1051:Olfr107 UTSW 17 37406450 missense possibly damaging 0.74
R4767:Olfr107 UTSW 17 37406200 nonsense probably null
R4849:Olfr107 UTSW 17 37405698 missense probably benign 0.16
R6182:Olfr107 UTSW 17 37405992 missense possibly damaging 0.65
R6550:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6551:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6552:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6555:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6584:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6586:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6588:Olfr107 UTSW 17 37405905 missense probably benign 0.30
R6758:Olfr107 UTSW 17 37405695 missense probably damaging 0.97
R7024:Olfr107 UTSW 17 37406204 missense probably benign 0.04
R7083:Olfr107 UTSW 17 37406172 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCAGTCAGCTCTCACTAGTGG -3'
(R):5'- CACTGAGGTGAGTGTCTGAG -3'

Sequencing Primer
(F):5'- AGTCAGCTCTCACTAGTGGATCTTTG -3'
(R):5'- CAGTAAGAGAGGCCTAGAATCAC -3'
Posted On2018-07-23