Incidental Mutation 'R6688:Cep120'
ID527878
Institutional Source Beutler Lab
Gene Symbol Cep120
Ensembl Gene ENSMUSG00000048799
Gene Namecentrosomal protein 120
SynonymsCcdc100
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.809) question?
Stock #R6688 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location53681724-53744547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 53724536 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 286 (P286S)
Ref Sequence ENSEMBL: ENSMUSP00000062433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049811]
Predicted Effect probably benign
Transcript: ENSMUST00000049811
AA Change: P286S

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000062433
Gene: ENSMUSG00000048799
AA Change: P286S

DomainStartEndE-ValueType
Pfam:C2 9 114 4.8e-5 PFAM
Pfam:DUF3668 118 340 1e-96 PFAM
low complexity region 378 396 N/A INTRINSIC
Pfam:C2 520 568 1.9e-3 PFAM
low complexity region 632 642 N/A INTRINSIC
SCOP:d1eq1a_ 661 803 2e-4 SMART
Meta Mutation Damage Score 0.0744 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the microtubule-dependent coupling of the nucleus and the centrosome. A similar protein in mouse plays a role in both interkinetic nuclear migration, which is a characteristic pattern of nuclear movement in neural progenitors, and in neural progenitor self-renewal. Mutations in this gene are predicted to result in neurogenic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic growth arrest at E8.5 and die during organogenesis exhibiting abnormal direction of heart looping. Primary mouse embryonic fibroblasts lack cilia and either one or both centrioles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn1 A T 13: 45,567,671 H249Q probably damaging Het
Cd22 A C 7: 30,872,964 S362A possibly damaging Het
Ces1g G A 8: 93,306,972 P441S possibly damaging Het
Ces2h A G 8: 105,017,840 I316V probably benign Het
Cntnap5c T A 17: 58,293,904 D747E possibly damaging Het
Cwf19l2 T C 9: 3,450,015 V572A probably benign Het
Cyb5rl C T 4: 107,073,905 A128V probably damaging Het
Dnttip1 T C 2: 164,765,161 Y241H probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Golga4 A G 9: 118,514,210 T11A possibly damaging Het
Ip6k2 C A 9: 108,806,011 T440K probably benign Het
Kif5c A G 2: 49,688,737 N126D probably benign Het
Mdn1 T A 4: 32,774,041 F5551I possibly damaging Het
Myh11 A G 16: 14,205,553 L1587P probably damaging Het
Nop53 A G 7: 15,945,854 V67A possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 T C 5: 27,744,137 T1045A probably benign Het
Pdzd3 C T 9: 44,248,230 probably null Het
Plg A T 17: 12,391,845 H215L probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rapgef2 T A 3: 79,069,128 Q1307L probably benign Het
Serpini2 T C 3: 75,259,563 E129G possibly damaging Het
Stx1b C T 7: 127,807,896 R209Q probably damaging Het
Tcf20 A G 15: 82,854,535 I905T possibly damaging Het
Tmem252 G A 19: 24,674,099 A11T probably benign Het
Tpst2 A G 5: 112,307,757 N54S probably benign Het
Usp31 T C 7: 121,678,330 S269G probably benign Het
Wasf1 T C 10: 40,926,620 probably null Het
Zfp429 A T 13: 67,396,130 V58D probably damaging Het
Zfp958 A G 8: 4,628,940 T322A possibly damaging Het
Other mutations in Cep120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Cep120 APN 18 53685961 missense probably benign 0.24
IGL01774:Cep120 APN 18 53706830 missense possibly damaging 0.92
IGL01862:Cep120 APN 18 53714767 missense probably benign 0.01
IGL01906:Cep120 APN 18 53714912 missense probably benign
IGL01941:Cep120 APN 18 53723148 missense probably benign 0.00
IGL02952:Cep120 APN 18 53683228 utr 3 prime probably benign
IGL03248:Cep120 APN 18 53735772 missense probably benign 0.04
IGL03379:Cep120 APN 18 53709136 missense probably benign
R0019:Cep120 UTSW 18 53709047 splice site probably benign
R0039:Cep120 UTSW 18 53685961 missense probably benign 0.24
R0763:Cep120 UTSW 18 53721737 missense probably benign 0.00
R1015:Cep120 UTSW 18 53703121 critical splice donor site probably null
R1340:Cep120 UTSW 18 53724391 missense probably damaging 1.00
R1507:Cep120 UTSW 18 53697657 missense probably damaging 0.99
R1649:Cep120 UTSW 18 53724576 missense probably damaging 1.00
R1727:Cep120 UTSW 18 53727729 missense probably benign 0.01
R1739:Cep120 UTSW 18 53719214 critical splice donor site probably null
R1873:Cep120 UTSW 18 53738488 missense probably damaging 0.98
R1913:Cep120 UTSW 18 53723286 missense probably benign 0.26
R1968:Cep120 UTSW 18 53723241 missense probably benign 0.42
R1995:Cep120 UTSW 18 53740136 missense probably damaging 1.00
R2042:Cep120 UTSW 18 53735742 missense possibly damaging 0.50
R2074:Cep120 UTSW 18 53719312 missense possibly damaging 0.83
R2116:Cep120 UTSW 18 53740136 missense probably damaging 1.00
R2215:Cep120 UTSW 18 53727635 missense probably damaging 1.00
R2697:Cep120 UTSW 18 53740125 missense probably benign 0.00
R3813:Cep120 UTSW 18 53740212 splice site probably benign
R4012:Cep120 UTSW 18 53738582 missense probably damaging 0.99
R4368:Cep120 UTSW 18 53685885 splice site probably null
R4615:Cep120 UTSW 18 53714841 missense probably damaging 1.00
R4772:Cep120 UTSW 18 53718489 missense probably damaging 1.00
R4780:Cep120 UTSW 18 53724536 missense probably benign 0.12
R5195:Cep120 UTSW 18 53721698 missense probably damaging 1.00
R5991:Cep120 UTSW 18 53721798 missense probably benign
R6156:Cep120 UTSW 18 53703223 missense probably benign 0.00
R6188:Cep120 UTSW 18 53724457 missense probably benign 0.03
R6961:Cep120 UTSW 18 53703205 nonsense probably null
R7143:Cep120 UTSW 18 53683385 missense probably benign 0.00
R7282:Cep120 UTSW 18 53740089 missense probably damaging 1.00
R7813:Cep120 UTSW 18 53738506 missense probably damaging 1.00
R7818:Cep120 UTSW 18 53723103 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCCTTCTCTCTGCAGAGC -3'
(R):5'- AGCAGACTCTTTAAGAACTGTGC -3'

Sequencing Primer
(F):5'- TTCTCTCTGCAGAGCCACGG -3'
(R):5'- AGAGGTTCTGAGTTCAATTCCCAGC -3'
Posted On2018-07-23