Mutagenetix > Incidental Mutation

Incidental Mutation 'R6688:Cep120'

527878

Institutional Source

Beutler Lab

Gene Symbol

Cep120

Ensembl Gene

ENSMUSG00000048799

Gene Name

centrosomal protein 120

Synonyms

Ccdc100

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.741) question?

Stock #

R6688 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

53681724-53744547 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 53724536 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 286 (P286S)

Ref Sequence

ENSEMBL: ENSMUSP00000062433 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049811]

AlphaFold

Q7TSG1

Predicted Effect

probably benign
Transcript: ENSMUST00000049811
AA Change: P286S

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000062433
Gene: ENSMUSG00000048799
AA Change: P286S

Domain	Start	End	E-Value	Type
Pfam:C2	9	114	4.8e-5	PFAM
Pfam:DUF3668	118	340	1e-96	PFAM
low complexity region	378	396	N/A	INTRINSIC
Pfam:C2	520	568	1.9e-3	PFAM
low complexity region	632	642	N/A	INTRINSIC
SCOP:d1eq1a_	661	803	2e-4	SMART

Meta Mutation Damage Score

0.0744

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the microtubule-dependent coupling of the nucleus and the centrosome. A similar protein in mouse plays a role in both interkinetic nuclear migration, which is a characteristic pattern of nuclear movement in neural progenitors, and in neural progenitor self-renewal. Mutations in this gene are predicted to result in neurogenic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic growth arrest at E8.5 and die during organogenesis exhibiting abnormal direction of heart looping. Primary mouse embryonic fibroblasts lack cilia and either one or both centrioles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atxn1	A	T	13: 45,567,671	H249Q	probably damaging	Het
Cd22	A	C	7: 30,872,964	S362A	possibly damaging	Het
Ces1g	G	A	8: 93,306,972	P441S	possibly damaging	Het
Ces2h	A	G	8: 105,017,840	I316V	probably benign	Het
Cntnap5c	T	A	17: 58,293,904	D747E	possibly damaging	Het
Cwf19l2	T	C	9: 3,450,015	V572A	probably benign	Het
Cyb5rl	C	T	4: 107,073,905	A128V	probably damaging	Het
Dnttip1	T	C	2: 164,765,161	Y241H	probably damaging	Het
Gm2381	G	A	7: 42,820,586	A38V	probably benign	Het
Golga4	A	G	9: 118,514,210	T11A	possibly damaging	Het
Ip6k2	C	A	9: 108,806,011	T440K	probably benign	Het
Kif5c	A	G	2: 49,688,737	N126D	probably benign	Het
Mdn1	T	A	4: 32,774,041	F5551I	possibly damaging	Het
Myh11	A	G	16: 14,205,553	L1587P	probably damaging	Het
Nop53	A	G	7: 15,945,854	V67A	possibly damaging	Het
Olfr107	G	A	17: 37,405,905	R119H	probably benign	Het
Paxip1	T	C	5: 27,744,137	T1045A	probably benign	Het
Pdzd3	C	T	9: 44,248,230		probably null	Het
Plg	A	T	17: 12,391,845	H215L	probably damaging	Het
Psmb5	C	A	14: 54,616,673	R116L	probably damaging	Het
Rapgef2	T	A	3: 79,069,128	Q1307L	probably benign	Het
Serpini2	T	C	3: 75,259,563	E129G	possibly damaging	Het
Stx1b	C	T	7: 127,807,896	R209Q	probably damaging	Het
Tcf20	A	G	15: 82,854,535	I905T	possibly damaging	Het
Tmem252	G	A	19: 24,674,099	A11T	probably benign	Het
Tpst2	A	G	5: 112,307,757	N54S	probably benign	Het
Usp31	T	C	7: 121,678,330	S269G	probably benign	Het
Wasf1	T	C	10: 40,926,620		probably null	Het
Zfp429	A	T	13: 67,396,130	V58D	probably damaging	Het
Zfp958	A	G	8: 4,628,940	T322A	possibly damaging	Het

Other mutations in Cep120

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01544:Cep120	APN	18	53685961	missense	probably benign	0.24
IGL01774:Cep120	APN	18	53706830	missense	possibly damaging	0.92
IGL01862:Cep120	APN	18	53714767	missense	probably benign	0.01
IGL01906:Cep120	APN	18	53714912	missense	probably benign
IGL01941:Cep120	APN	18	53723148	missense	probably benign	0.00
IGL02952:Cep120	APN	18	53683228	utr 3 prime	probably benign
IGL03248:Cep120	APN	18	53735772	missense	probably benign	0.04
IGL03379:Cep120	APN	18	53709136	missense	probably benign
R0019:Cep120	UTSW	18	53709047	splice site	probably benign
R0039:Cep120	UTSW	18	53685961	missense	probably benign	0.24
R0763:Cep120	UTSW	18	53721737	missense	probably benign	0.00
R1015:Cep120	UTSW	18	53703121	critical splice donor site	probably null
R1340:Cep120	UTSW	18	53724391	missense	probably damaging	1.00
R1507:Cep120	UTSW	18	53697657	missense	probably damaging	0.99
R1649:Cep120	UTSW	18	53724576	missense	probably damaging	1.00
R1727:Cep120	UTSW	18	53727729	missense	probably benign	0.01
R1739:Cep120	UTSW	18	53719214	critical splice donor site	probably null
R1873:Cep120	UTSW	18	53738488	missense	probably damaging	0.98
R1913:Cep120	UTSW	18	53723286	missense	probably benign	0.26
R1968:Cep120	UTSW	18	53723241	missense	probably benign	0.42
R1995:Cep120	UTSW	18	53740136	missense	probably damaging	1.00
R2042:Cep120	UTSW	18	53735742	missense	possibly damaging	0.50
R2074:Cep120	UTSW	18	53719312	missense	possibly damaging	0.83
R2116:Cep120	UTSW	18	53740136	missense	probably damaging	1.00
R2215:Cep120	UTSW	18	53727635	missense	probably damaging	1.00
R2697:Cep120	UTSW	18	53740125	missense	probably benign	0.00
R3813:Cep120	UTSW	18	53740212	splice site	probably benign
R4012:Cep120	UTSW	18	53738582	missense	probably damaging	0.99
R4368:Cep120	UTSW	18	53685885	splice site	probably null
R4615:Cep120	UTSW	18	53714841	missense	probably damaging	1.00
R4772:Cep120	UTSW	18	53718489	missense	probably damaging	1.00
R4780:Cep120	UTSW	18	53724536	missense	probably benign	0.12
R5195:Cep120	UTSW	18	53721698	missense	probably damaging	1.00
R5991:Cep120	UTSW	18	53721798	missense	probably benign
R6156:Cep120	UTSW	18	53703223	missense	probably benign	0.00
R6188:Cep120	UTSW	18	53724457	missense	probably benign	0.03
R6961:Cep120	UTSW	18	53703205	nonsense	probably null
R7143:Cep120	UTSW	18	53683385	missense	probably benign	0.00
R7282:Cep120	UTSW	18	53740089	missense	probably damaging	1.00
R7813:Cep120	UTSW	18	53738506	missense	probably damaging	1.00
R7818:Cep120	UTSW	18	53723103	missense	probably benign
R8677:Cep120	UTSW	18	53738561	missense	possibly damaging	0.90
R8724:Cep120	UTSW	18	53723127	missense	possibly damaging	0.88
R9164:Cep120	UTSW	18	53719246	missense	probably benign	0.02
R9225:Cep120	UTSW	18	53706824	missense	probably benign	0.00
R9300:Cep120	UTSW	18	53719297	missense	probably damaging	0.99
R9312:Cep120	UTSW	18	53727641	missense	probably benign	0.08
R9377:Cep120	UTSW	18	53718520	missense	possibly damaging	0.66
R9390:Cep120	UTSW	18	53706912	nonsense	probably null
R9499:Cep120	UTSW	18	53685961	missense	possibly damaging	0.94
R9551:Cep120	UTSW	18	53685961	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- ATGCCTTCTCTCTGCAGAGC -3'
(R):5'- AGCAGACTCTTTAAGAACTGTGC -3'

Sequencing Primer
(F):5'- TTCTCTCTGCAGAGCCACGG -3'
(R):5'- AGAGGTTCTGAGTTCAATTCCCAGC -3'

Posted On

2018-07-23