Incidental Mutation 'R6688:Tmem252'
ID527879
Institutional Source Beutler Lab
Gene Symbol Tmem252
Ensembl Gene ENSMUSG00000048572
Gene Nametransmembrane protein 252
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6688 (G1)
Quality Score126.008
Status Validated
Chromosome19
Chromosomal Location24674008-24679661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24674099 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 11 (A11T)
Ref Sequence ENSEMBL: ENSMUSP00000060863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057243]
Predicted Effect probably benign
Transcript: ENSMUST00000057243
AA Change: A11T

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000060863
Gene: ENSMUSG00000048572
AA Change: A11T

DomainStartEndE-ValueType
Pfam:TMEM252 28 166 5.2e-73 PFAM
Meta Mutation Damage Score 0.1655 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn1 A T 13: 45,567,671 H249Q probably damaging Het
Cd22 A C 7: 30,872,964 S362A possibly damaging Het
Cep120 G A 18: 53,724,536 P286S probably benign Het
Ces1g G A 8: 93,306,972 P441S possibly damaging Het
Ces2h A G 8: 105,017,840 I316V probably benign Het
Cntnap5c T A 17: 58,293,904 D747E possibly damaging Het
Cwf19l2 T C 9: 3,450,015 V572A probably benign Het
Cyb5rl C T 4: 107,073,905 A128V probably damaging Het
Dnttip1 T C 2: 164,765,161 Y241H probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Golga4 A G 9: 118,514,210 T11A possibly damaging Het
Ip6k2 C A 9: 108,806,011 T440K probably benign Het
Kif5c A G 2: 49,688,737 N126D probably benign Het
Mdn1 T A 4: 32,774,041 F5551I possibly damaging Het
Myh11 A G 16: 14,205,553 L1587P probably damaging Het
Nop53 A G 7: 15,945,854 V67A possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 T C 5: 27,744,137 T1045A probably benign Het
Pdzd3 C T 9: 44,248,230 probably null Het
Plg A T 17: 12,391,845 H215L probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rapgef2 T A 3: 79,069,128 Q1307L probably benign Het
Serpini2 T C 3: 75,259,563 E129G possibly damaging Het
Stx1b C T 7: 127,807,896 R209Q probably damaging Het
Tcf20 A G 15: 82,854,535 I905T possibly damaging Het
Tpst2 A G 5: 112,307,757 N54S probably benign Het
Usp31 T C 7: 121,678,330 S269G probably benign Het
Wasf1 T C 10: 40,926,620 probably null Het
Zfp429 A T 13: 67,396,130 V58D probably damaging Het
Zfp958 A G 8: 4,628,940 T322A possibly damaging Het
Other mutations in Tmem252
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2079:Tmem252 UTSW 19 24677653 missense probably benign 0.09
R2269:Tmem252 UTSW 19 24674091 missense probably benign 0.25
R4419:Tmem252 UTSW 19 24677546 missense probably damaging 1.00
R5241:Tmem252 UTSW 19 24674127 missense probably benign 0.20
R5974:Tmem252 UTSW 19 24674268 missense probably benign 0.00
R7008:Tmem252 UTSW 19 24674292 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCCTGGAGGATGTTACAGTAACTTC -3'
(R):5'- TGAGCACGTGGTTGAACATC -3'

Sequencing Primer
(F):5'- CCAGTGGTTAATGAATAGCTTCCCG -3'
(R):5'- AGCACGTGGTTGAACATCTCTTTG -3'
Posted On2018-07-23