Incidental Mutation 'R6689:Grem1'
ID527881
Institutional Source Beutler Lab
Gene Symbol Grem1
Ensembl Gene ENSMUSG00000074934
Gene Namegremlin 1, DAN family BMP antagonist
SynonymsDrm, Grem, Cktsf1b1, gremlin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6689 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location113746164-113758646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113749931 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 75 (E75G)
Ref Sequence ENSEMBL: ENSMUSP00000097170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099575]
Predicted Effect probably benign
Transcript: ENSMUST00000099575
AA Change: E75G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000097170
Gene: ENSMUSG00000074934
AA Change: E75G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 49 66 N/A INTRINSIC
CT 96 183 2.36e-30 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the BMP (bone morphogenic protein) antagonist family. Like BMPs, BMP antagonists contain cystine knots and typically form homo- and heterodimers. The CAN (cerberus and dan) subfamily of BMP antagonists, to which this gene belongs, is characterized by a C-terminal cystine knot with an eight-membered ring. The antagonistic effect of the secreted glycosylated protein encoded by this gene is likely due to its direct binding to BMP proteins. As an antagonist of BMP, this gene may play a role in regulating organogenesis, body patterning, and tissue differentiation. In mouse, this protein has been shown to relay the sonic hedgehog (SHH) signal from the polarizing region to the apical ectodermal ridge during limb bud outgrowth. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous null mice display neonatal lethality with bilateral agenesis of the kidneys and ureters, oligodactyly, limb skeletal malformations, cyanosis, dyspnea, and abnormal lung morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,589,109 probably null Het
Ankk1 T A 9: 49,420,476 I173F probably damaging Het
Aurka A G 2: 172,370,393 probably null Het
B4galnt4 C T 7: 141,067,984 T471I probably benign Het
Commd6 C A 14: 101,640,459 probably benign Het
Cyr61 T A 3: 145,647,788 M340L probably benign Het
Elobl T C 11: 88,965,093 N48S possibly damaging Het
Hp C T 8: 109,575,720 V199I probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Lgr5 T A 10: 115,466,608 I293F probably damaging Het
Lmln A G 16: 33,104,782 R462G probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Mroh4 A G 15: 74,612,003 V495A probably damaging Het
Olfr1100 A G 2: 86,978,154 I214T probably benign Het
Olfr95 C G 17: 37,211,157 G232A probably damaging Het
Stim2 G A 5: 54,115,976 R524H probably damaging Het
Other mutations in Grem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Grem1 APN 2 113749787 missense probably damaging 0.99
R0789:Grem1 UTSW 2 113749711 missense probably benign 0.05
R1771:Grem1 UTSW 2 113749676 missense probably benign 0.00
R4065:Grem1 UTSW 2 113749688 missense probably damaging 1.00
R7850:Grem1 UTSW 2 113749833 missense probably damaging 1.00
R7933:Grem1 UTSW 2 113749833 missense probably damaging 1.00
Z1177:Grem1 UTSW 2 113749649 missense not run
Predicted Primers PCR Primer
(F):5'- AGCAAGACTGAAAGGACCCTTC -3'
(R):5'- ATACACTGTGGGAGCGTTGC -3'

Sequencing Primer
(F):5'- GGACCCTTCCTCCTTTCGGATG -3'
(R):5'- GGGAGCGTTGCTTCTCCTC -3'
Posted On2018-07-23