Incidental Mutation 'R6689:Aurka'
ID527882
Institutional Source Beutler Lab
Gene Symbol Aurka
Ensembl Gene ENSMUSG00000027496
Gene Nameaurora kinase A
SynonymsIAK, IAK1, Aurora-A, aurora A, Ark1, Ayk1, AIRK1, Stk6
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_011497.3; MGI:894678

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6689 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location172356190-172370535 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 172370393 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028997] [ENSMUST00000109139] [ENSMUST00000109140] [ENSMUST00000116375] [ENSMUST00000151511]
Predicted Effect probably null
Transcript: ENSMUST00000028997
SMART Domains Protein: ENSMUSP00000028997
Gene: ENSMUSG00000027496

DomainStartEndE-ValueType
S_TKc 146 396 2.25e-99 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109139
SMART Domains Protein: ENSMUSP00000104767
Gene: ENSMUSG00000027496

DomainStartEndE-ValueType
S_TKc 124 374 2.25e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109140
SMART Domains Protein: ENSMUSP00000104768
Gene: ENSMUSG00000027496

DomainStartEndE-ValueType
S_TKc 124 374 2.25e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116375
SMART Domains Protein: ENSMUSP00000112076
Gene: ENSMUSG00000027498

DomainStartEndE-ValueType
Pfam:CSTF1_dimer 6 62 5.4e-28 PFAM
WD40 97 136 2.61e-3 SMART
WD40 162 201 3.29e-9 SMART
WD40 206 245 6.88e0 SMART
WD40 248 290 9.02e-7 SMART
WD40 293 334 1.44e-5 SMART
Blast:WD40 337 382 8e-9 BLAST
WD40 385 425 2.49e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126107
Predicted Effect probably benign
Transcript: ENSMUST00000151511
SMART Domains Protein: ENSMUSP00000121178
Gene: ENSMUSG00000027498

DomainStartEndE-ValueType
PDB:2XZ2|A 8 59 2e-7 PDB
WD40 97 136 2.61e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype Strain: 3836423; 3826513
Lethality: E1-E4
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell cycle-regulated kinase that appears to be involved in microtubule formation and/or stabilization at the spindle pole during chromosome segregation. The encoded protein is found at the centrosome in interphase cells and at the spindle poles in mitosis. This gene may play a role in tumor development and progression. A processed pseudogene of this gene has been found on chromosome 1, and an unprocessed pseudogene has been found on chromosome 10. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before implantation, early embryonic growth arrest, and impaired mitosis. Heterozygous null mice display increased incidence of tumors primarily lymphomas and chromosomal instability. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(4) Gene trapped(21)

Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,589,109 probably null Het
Ankk1 T A 9: 49,420,476 I173F probably damaging Het
B4galnt4 C T 7: 141,067,984 T471I probably benign Het
Commd6 C A 14: 101,640,459 probably benign Het
Cyr61 T A 3: 145,647,788 M340L probably benign Het
Elobl T C 11: 88,965,093 N48S possibly damaging Het
Grem1 T C 2: 113,749,931 E75G probably benign Het
Hp C T 8: 109,575,720 V199I probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Lgr5 T A 10: 115,466,608 I293F probably damaging Het
Lmln A G 16: 33,104,782 R462G probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Mroh4 A G 15: 74,612,003 V495A probably damaging Het
Olfr1100 A G 2: 86,978,154 I214T probably benign Het
Olfr95 C G 17: 37,211,157 G232A probably damaging Het
Stim2 G A 5: 54,115,976 R524H probably damaging Het
Other mutations in Aurka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Aurka APN 2 172368979 unclassified probably benign
IGL02338:Aurka APN 2 172359858 missense probably benign 0.00
IGL02894:Aurka APN 2 172366948 unclassified probably null
IGL03188:Aurka APN 2 172363768 missense possibly damaging 0.60
PIT4585001:Aurka UTSW 2 172357197 missense probably benign 0.01
R0006:Aurka UTSW 2 172359753 critical splice donor site probably null
R0006:Aurka UTSW 2 172359753 critical splice donor site probably null
R0458:Aurka UTSW 2 172370446 nonsense probably null
R0555:Aurka UTSW 2 172367147 missense probably benign 0.07
R1130:Aurka UTSW 2 172357258 splice site probably null
R1140:Aurka UTSW 2 172357229 missense probably damaging 1.00
R2507:Aurka UTSW 2 172370445 missense probably benign 0.00
R2887:Aurka UTSW 2 172367120 missense probably benign 0.01
R2889:Aurka UTSW 2 172367120 missense probably benign 0.01
R3772:Aurka UTSW 2 172366960 missense probably benign
R4929:Aurka UTSW 2 172370406 missense probably benign 0.05
R5409:Aurka UTSW 2 172367116 missense possibly damaging 0.78
R6158:Aurka UTSW 2 172363596 critical splice donor site probably null
R6828:Aurka UTSW 2 172357252 missense probably damaging 1.00
R7912:Aurka UTSW 2 172369029 missense probably benign 0.00
R7993:Aurka UTSW 2 172369029 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTCTCCACCCGAAGCAGTC -3'
(R):5'- AATCACAGAACGGCATTGCTCC -3'

Sequencing Primer
(F):5'- GTCCCCAATAAGCCGCAGTTC -3'
(R):5'- TAGCCAATCAGCTCTTGGAG -3'
Posted On2018-07-23