Incidental Mutation 'R6689:Stim2'
ID527885
Institutional Source Beutler Lab
Gene Symbol Stim2
Ensembl Gene ENSMUSG00000039156
Gene Namestromal interaction molecule 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6689 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location53998499-54121057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 54115976 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 524 (R524H)
Ref Sequence ENSEMBL: ENSMUSP00000143855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117661] [ENSMUST00000201469]
Predicted Effect probably damaging
Transcript: ENSMUST00000117661
AA Change: R516H

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113174
Gene: ENSMUSG00000039156
AA Change: R516H

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
SAM 133 204 1.74e-3 SMART
PDB:4O9B|D 241 344 2e-36 PDB
PDB:3TEQ|D 348 448 2e-38 PDB
low complexity region 505 518 N/A INTRINSIC
low complexity region 527 557 N/A INTRINSIC
low complexity region 602 613 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000201198
AA Change: R153H
Predicted Effect probably damaging
Transcript: ENSMUST00000201469
AA Change: R524H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143855
Gene: ENSMUSG00000039156
AA Change: R524H

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
SAM 133 204 1.74e-3 SMART
PDB:4O9B|D 241 344 2e-36 PDB
Pfam:SOAR 345 453 1.7e-42 PFAM
low complexity region 513 526 N/A INTRINSIC
low complexity region 535 565 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 738 754 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202342
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the stromal interaction molecule (STIM) family and likely arose, along with related family member STIM1, from a common ancestral gene. The encoded protein functions to regulate calcium concentrations in the cytosol and endoplasmic reticulum, and is involved in the activation of plasma membrane Orai Ca(2+) entry channels. This gene initiates translation from a non-AUG (UUG) start site. A signal peptide is cleaved from the resulting protein. Multiple transcript variants result from alternative splicing. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit a slight growth delay and premature death while embryonic fibroblasts show reduced store-operated Ca2+ influx. Mice homozygous for a different null allele show increased neuron survival under hypoxic conditions and resistance to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,589,109 probably null Het
Ankk1 T A 9: 49,420,476 I173F probably damaging Het
Aurka A G 2: 172,370,393 probably null Het
B4galnt4 C T 7: 141,067,984 T471I probably benign Het
Commd6 C A 14: 101,640,459 probably benign Het
Cyr61 T A 3: 145,647,788 M340L probably benign Het
Elobl T C 11: 88,965,093 N48S possibly damaging Het
Grem1 T C 2: 113,749,931 E75G probably benign Het
Hp C T 8: 109,575,720 V199I probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Lgr5 T A 10: 115,466,608 I293F probably damaging Het
Lmln A G 16: 33,104,782 R462G probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Mroh4 A G 15: 74,612,003 V495A probably damaging Het
Olfr1100 A G 2: 86,978,154 I214T probably benign Het
Olfr95 C G 17: 37,211,157 G232A probably damaging Het
Other mutations in Stim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Stim2 APN 5 54053493 missense probably benign 0.09
IGL02276:Stim2 APN 5 54053370 splice site probably benign
IGL02643:Stim2 APN 5 54110613 missense probably damaging 1.00
R0368:Stim2 UTSW 5 54110140 critical splice donor site probably null
R0825:Stim2 UTSW 5 54118483 missense probably benign 0.22
R1453:Stim2 UTSW 5 54116109 missense probably damaging 1.00
R1549:Stim2 UTSW 5 54105325 missense probably damaging 1.00
R2103:Stim2 UTSW 5 54105249 missense possibly damaging 0.74
R2114:Stim2 UTSW 5 54104477 missense probably damaging 1.00
R2147:Stim2 UTSW 5 54105375 missense probably damaging 1.00
R2159:Stim2 UTSW 5 54109814 missense probably damaging 1.00
R4467:Stim2 UTSW 5 54116194 critical splice donor site probably null
R4809:Stim2 UTSW 5 54110613 missense probably damaging 1.00
R4857:Stim2 UTSW 5 54118546 missense probably damaging 1.00
R4959:Stim2 UTSW 5 54105370 missense probably benign
R5125:Stim2 UTSW 5 54110597 missense probably damaging 1.00
R5427:Stim2 UTSW 5 54110939 missense possibly damaging 0.95
R5441:Stim2 UTSW 5 54075370 nonsense probably null
R5617:Stim2 UTSW 5 54109733 missense probably damaging 0.99
R5924:Stim2 UTSW 5 54102643 missense probably benign 0.01
R6169:Stim2 UTSW 5 54118679 missense probably damaging 1.00
R6893:Stim2 UTSW 5 54053445 missense probably benign 0.13
R6971:Stim2 UTSW 5 54118299 nonsense probably null
R7133:Stim2 UTSW 5 53998921 missense possibly damaging 0.70
R7189:Stim2 UTSW 5 54116128 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCCATTGGTTGTAGAGAAGGGC -3'
(R):5'- GAAGTAGATAGCCTCCTCCTCCTC -3'

Sequencing Primer
(F):5'- CCATTGGTTGTAGAGAAGGGCATTTG -3'
(R):5'- TCTTCGTTCCGATACAGAGCAGG -3'
Posted On2018-07-23