Incidental Mutation 'R6689:B4galnt4'
ID527888
Institutional Source Beutler Lab
Gene Symbol B4galnt4
Ensembl Gene ENSMUSG00000055629
Gene Namebeta-1,4-N-acetyl-galactosaminyl transferase 4
SynonymsLOC381951
MMRRC Submission
Accession Numbers

Genbank: NM_177897; MGI: 2652891

Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R6689 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location141061104-141072400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 141067984 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 471 (T471I)
Ref Sequence ENSEMBL: ENSMUSP00000039758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048002]
Predicted Effect probably benign
Transcript: ENSMUST00000048002
AA Change: T471I

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000039758
Gene: ENSMUSG00000055629
AA Change: T471I

DomainStartEndE-ValueType
transmembrane domain 13 31 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
PA14 129 276 6.07e-7 SMART
low complexity region 412 421 N/A INTRINSIC
low complexity region 433 449 N/A INTRINSIC
low complexity region 461 481 N/A INTRINSIC
low complexity region 634 660 N/A INTRINSIC
Pfam:CHGN 691 1024 8.9e-31 PFAM
Pfam:Glyco_transf_7C 939 1017 1.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210203
Predicted Effect probably benign
Transcript: ENSMUST00000210517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211455
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Gene trapped(2)

Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,589,109 probably null Het
Ankk1 T A 9: 49,420,476 I173F probably damaging Het
Aurka A G 2: 172,370,393 probably null Het
Commd6 C A 14: 101,640,459 probably benign Het
Cyr61 T A 3: 145,647,788 M340L probably benign Het
Elobl T C 11: 88,965,093 N48S possibly damaging Het
Grem1 T C 2: 113,749,931 E75G probably benign Het
Hp C T 8: 109,575,720 V199I probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Lgr5 T A 10: 115,466,608 I293F probably damaging Het
Lmln A G 16: 33,104,782 R462G probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Mroh4 A G 15: 74,612,003 V495A probably damaging Het
Olfr1100 A G 2: 86,978,154 I214T probably benign Het
Olfr95 C G 17: 37,211,157 G232A probably damaging Het
Stim2 G A 5: 54,115,976 R524H probably damaging Het
Other mutations in B4galnt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:B4galnt4 APN 7 141070515 missense probably benign 0.15
IGL02055:B4galnt4 APN 7 141070818 missense probably damaging 1.00
IGL02248:B4galnt4 APN 7 141067808 unclassified probably benign
IGL02955:B4galnt4 APN 7 141064678 missense probably null 0.08
IGL03334:B4galnt4 APN 7 141067441 splice site probably null
H8786:B4galnt4 UTSW 7 141071322 missense probably damaging 0.99
R0520:B4galnt4 UTSW 7 141067373 nonsense probably null
R0735:B4galnt4 UTSW 7 141064323 missense probably benign 0.24
R1355:B4galnt4 UTSW 7 141065395 missense probably damaging 1.00
R1864:B4galnt4 UTSW 7 141070533 missense probably damaging 1.00
R1874:B4galnt4 UTSW 7 141070526 missense probably damaging 1.00
R1928:B4galnt4 UTSW 7 141068148 nonsense probably null
R1969:B4galnt4 UTSW 7 141064848 missense probably benign 0.01
R3429:B4galnt4 UTSW 7 141070839 missense probably damaging 1.00
R4239:B4galnt4 UTSW 7 141061326 missense probably damaging 1.00
R4382:B4galnt4 UTSW 7 141070536 missense probably damaging 0.99
R4517:B4galnt4 UTSW 7 141067722 missense probably damaging 1.00
R4748:B4galnt4 UTSW 7 141071720 missense probably damaging 1.00
R4827:B4galnt4 UTSW 7 141068479 missense probably benign 0.00
R4831:B4galnt4 UTSW 7 141067721 missense probably damaging 0.99
R4831:B4galnt4 UTSW 7 141064557 critical splice donor site probably null
R4898:B4galnt4 UTSW 7 141068260 missense probably benign 0.11
R5028:B4galnt4 UTSW 7 141068062 missense probably benign 0.40
R5249:B4galnt4 UTSW 7 141065070 missense probably damaging 1.00
R5267:B4galnt4 UTSW 7 141070611 missense probably damaging 0.99
R5728:B4galnt4 UTSW 7 141070575 missense probably benign 0.00
R5924:B4galnt4 UTSW 7 141070829 missense probably damaging 1.00
R6063:B4galnt4 UTSW 7 141064730 missense probably benign 0.08
R6311:B4galnt4 UTSW 7 141068659 missense probably damaging 1.00
R6376:B4galnt4 UTSW 7 141067422 missense possibly damaging 0.87
R6954:B4galnt4 UTSW 7 141067232 missense probably benign 0.01
R6974:B4galnt4 UTSW 7 141067536 missense possibly damaging 0.95
R7041:B4galnt4 UTSW 7 141070680 missense probably damaging 1.00
R7092:B4galnt4 UTSW 7 141068636 missense probably damaging 1.00
R7359:B4galnt4 UTSW 7 141071284 missense probably damaging 1.00
R7367:B4galnt4 UTSW 7 141064475 missense probably damaging 1.00
R7409:B4galnt4 UTSW 7 141067003 splice site probably null
R7519:B4galnt4 UTSW 7 141064344 missense probably damaging 1.00
R7664:B4galnt4 UTSW 7 141067713 missense probably damaging 1.00
R7679:B4galnt4 UTSW 7 141067765 missense probably benign 0.28
R7782:B4galnt4 UTSW 7 141065075 missense probably damaging 1.00
RF007:B4galnt4 UTSW 7 141070696 critical splice donor site probably null
YA93:B4galnt4 UTSW 7 141067411 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- CTCTTCCTCAACCCAGATGG -3'
(R):5'- TGTCCATGTAACTGGCCCTC -3'

Sequencing Primer
(F):5'- CCCAGATGGTGAGTGTCTCG -3'
(R):5'- AGGGTGAGTCTCGCAATGC -3'
Posted On2018-07-23