Incidental Mutation 'R6689:Hp'
ID527889
Institutional Source Beutler Lab
Gene Symbol Hp
Ensembl Gene ENSMUSG00000031722
Gene Namehaptoglobin
SynonymsHP-1, preHP2, zonulin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R6689 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location109575128-109579172 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 109575720 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 199 (V199I)
Ref Sequence ENSEMBL: ENSMUSP00000074436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034159] [ENSMUST00000074898] [ENSMUST00000178445]
Predicted Effect probably benign
Transcript: ENSMUST00000034159
SMART Domains Protein: ENSMUSP00000034159
Gene: ENSMUSG00000031723

DomainStartEndE-ValueType
Pfam:DIM1 4 136 1.6e-58 PFAM
Pfam:Thioredoxin 6 109 3.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074898
AA Change: V199I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000074436
Gene: ENSMUSG00000031722
AA Change: V199I

DomainStartEndE-ValueType
CCP 33 86 2.9e0 SMART
Tryp_SPc 102 340 4.38e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178445
SMART Domains Protein: ENSMUSP00000137524
Gene: ENSMUSG00000031723

DomainStartEndE-ValueType
Pfam:DIM1 4 136 1.2e-58 PFAM
Pfam:Thioredoxin 6 110 2.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212918
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a plasma glycoprotein called haptoglobin that binds free hemoglobin. The encoded preproprotein undergoes proteolytic processing to generate alpha and beta subunits that form a disulfide-linked tetrameric protein that plays an important role in the sequestration and clearance of extracorpuscular hemoglobin. Mice lacking the encoded protein exhibit stunted development of lymphoid organs associated with lower counts of mature T and B cells in the blood and secondary lymphoid compartments. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for a null allele exhibit partial postnatal lethality, susceptibility to induced acute hemolysis, and altered renal iron loading during aging and after ischemic injury. Homozygotes for a knock-in allele show reduced cholesterol efflux and enhanced nephropathy in STZ-induced diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,589,109 probably null Het
Ankk1 T A 9: 49,420,476 I173F probably damaging Het
Aurka A G 2: 172,370,393 probably null Het
B4galnt4 C T 7: 141,067,984 T471I probably benign Het
Commd6 C A 14: 101,640,459 probably benign Het
Cyr61 T A 3: 145,647,788 M340L probably benign Het
Elobl T C 11: 88,965,093 N48S possibly damaging Het
Grem1 T C 2: 113,749,931 E75G probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Lgr5 T A 10: 115,466,608 I293F probably damaging Het
Lmln A G 16: 33,104,782 R462G probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Mroh4 A G 15: 74,612,003 V495A probably damaging Het
Olfr1100 A G 2: 86,978,154 I214T probably benign Het
Olfr95 C G 17: 37,211,157 G232A probably damaging Het
Stim2 G A 5: 54,115,976 R524H probably damaging Het
Other mutations in Hp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Hp APN 8 109575618 unclassified probably null
IGL00951:Hp APN 8 109577497 missense possibly damaging 0.71
IGL01013:Hp APN 8 109579021 utr 5 prime probably benign
IGL01096:Hp APN 8 109575401 missense probably benign
IGL01307:Hp APN 8 109575783 missense probably benign 0.05
IGL02997:Hp APN 8 109575786 missense probably damaging 1.00
IGL03378:Hp APN 8 109575707 missense probably damaging 0.99
R1349:Hp UTSW 8 109575306 missense probably benign 0.00
R1691:Hp UTSW 8 109575572 missense probably benign 0.09
R4741:Hp UTSW 8 109575472 nonsense probably null
R6036:Hp UTSW 8 109576774 unclassified probably null
R6036:Hp UTSW 8 109576774 unclassified probably null
R7426:Hp UTSW 8 109575200 utr 3 prime probably null
R7683:Hp UTSW 8 109579099 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AAGATAGGCTGGACCCCAAC -3'
(R):5'- CGTTGATCAGTGACCAGTGG -3'

Sequencing Primer
(F):5'- CGGGCACTGTACTATTCTCATAGTG -3'
(R):5'- ATCAGTGACCAGTGGCTGCTG -3'
Posted On2018-07-23